what is cell?
BRIEFLY EXPLAIN.

Humans reproduce via the reproduction that is taking place in this fertilization that is sexual. Humans reproduce via sexual reproduction.Humans reproduce via sexual reproduction.

These are defined as the thread like structures that are located inside the nucleus of animal and plant cells and these each of them contain DNA and proteins.

 This karyotype represents human cells after fertilization.This karyotype represents human cells after fertilization. This is showing that the human cells that are representing the cells of human reproduction. Each individual inherits one of each pair from each parent.Each individual inherits one of each pair from each parent.

Each of the human genome contains 23 pairs of chromosomes where 22 are autosomes as clearly shown in picture and then one last is the sex chromosome pair where it can be XX or XY where XX is the female child and XY is the male child.

Learn more about chromosomes at :

https://brainly.com/question/296477

#SPJ1

The most common type of connective tissue in the typical human body is adipose tissue, which is also known as fat. However, cartilage is also an important type of connective tissue that provides support and flexibility to various structures in the body.

Cartilage is a tough, elastic tissue that covers the ends of bones in joints and helps to cushion them during movement. It is also found in other areas of the body such as the ears, nose, and trachea. While cartilage is not as abundant as adipose tissue, it plays a critical role in maintaining the structure and function of many organs and tissues.

Cartilage is made up of specialized cells called chondrocytes that produce a matrix of collagen and proteoglycans, which give the tissue its strength and elasticity. When cartilage is damaged or worn down, it can lead to conditions such as osteoarthritis, where the bones in a joint rub against each other without the protective cushioning of the cartilage.

To know more about connective tissue

https://brainly.com/question/1985662

#SPJ11

Answer: The DNA sequence CATCGATACCATTCGGCGCATACTTCG translates to the mRNA sequence GUAGCUAUCCUAAGCCGCGUAUGAAGC

Explanation: To translate a DNA sequence into amino acids, we need to first transcribe it to mRNA. This is done by changing T (thymine) to U (uracil). So in this case, the DNA sequence

CATCGATACCATTCGGCGCATACTTCG

transcribes to the mRNA sequence

GUAGCUAUCCUAAGCCGCGUAUGAAGC.

The next step is to divide the mRNA sequence into codons. A codon is a sequence of three nucleotides that codes for one amino acid. In this case, the codons are:

GUU (Val) GCU (Ala) UAU (Tyr) CCU (Pro) AAU (Asn) GCG (Ala) UAU (Tyr) GAA (Glu)

The sequence ends with a stop codon, which does not code for an amino acid.

Using the genetic code, we can convert each codon to its corresponding amino acid. The resulting polypeptide sequence is:

Val-Ser-Ile-Leu-Ser-Ala-Val-Stop.

Therefore, the DNA sequence CATCGATACCATTCGGCGCATACTTCG translates to the polypeptide sequence Val-Ser-Ile-Leu-Ser-Ala-Val-Stop.

Hope this helps, and have a great day!

Answer:

false

Explanation:

Protein denaturation can be brought about by all of the following except cooling the protein.

Protein denaturation is the breakdown or unfolding of a protein's structure, which results in the loss of its functional capabilities.

Denaturation can be triggered by a variety of circumstances, including heating the protein, exposing it to a strong acid, and treating it with disulfide bond-breaking chemicals.

These circumstances have the potential to disturb the non-covalent interactions and disulfide bonds that contribute to the folded structure of the protein.

As a result, chilling the protein is an exception among the mentioned choices because it is not a factor that generally causes protein denaturation.

For more details regarding protein denaturation, visit:

https://brainly.com/question/33442790

#SPJ12

Your question seems incomplete, the probable complete question is:

Protein denaturation can be brought about by all of the following except: cooling the protein heating the protein placing the protein in a strong acid, which disrupts hydrogen bonding treating the protein with compounds that break disulfide bonds

A redox (reduction-oxidation) reaction is a chemical reaction that involves a transfer of electrons from one species (the reducing agent) to another species (the oxidizing agent). The two events that occur during a redox reaction are:

Reduction: The reducing agent gains electrons, which results in an increase in its oxidation state and a decrease in its electron configuration. This is referred to as reduction.

Oxidation: The oxidizing agent loses electrons, which results in a decrease in its oxidation state and an increase in its electron configuration. This is referred to as oxidation.

These two events occur simultaneously and are interdependent, as the reduction of one species is accompanied by the oxidation of another. The overall change in the electron configuration that occurs during a redox reaction results in a change in the oxidation states of the species involved, which can be monitored and used to identify the species and their reactions.

Learn more about redox reactions at:

brainly.com/question/13293425

Answer:

ram

Explanation:

Answer:

they may "loop out" of the cell cycle and into a resting state called G0, from which they may subsequently re-enter G1 under the appropriate conditions

Explanation:

At the G1 checkpoint, cells decide whether or not to proceed with division based on factors such as: Cell size

1.  The heat from radioactive action within the interior of the planet causes the plates to move, sometimes toward and sometimes away from each other.

2. Earth's surface activates with respect to tectonic theory, moving as much as 1-2 inches a year. The many tectonic plates shift and interact with each other. This motion transform the Earth's outer layer. Hence the movement may causes Earthquakes, volcanoes and mountains .

3.Plate motions cause mountains to rise where plates are push together, or converge, and continents to fracture and oceans to form where plates pull apart, or diverge. Hence it results in formation of mountain, ocean and continents .

To learn more more about Earth's surface , here

brainly.com/question/13459956

#SPJ1

Answer:

Answer: Adaptive radiation

Answer:

I think its A

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

a. The labor productivity ratio for Mack's guitar fabrication shop is approximately 0.5 guitars per hour. b. The new sales price per guitar would be $276, the new percentage of guitars considered good enough to sell would be 85% and the new costs per guitar would be $ 33.15.

a) In order to calculate the labor productivity ratio,

Labor Productivity Ratio = Number of Guitars Produced / Total Labor Hours

Labor Productivity Ratio = 78 guitars / (160 hours/employee)

Labor Productivity Ratio = 0.4875 guitars per hour

Rounding to one decimal place, the labor productivity ratio for Mack's guitar fabrication shop is approximately 0.5 guitars per hour.

b) Option 1: Increasing the sales price by 15%:

The new sales price per guitar would be $240 + (15% of $240) = $276.

Option 2: Improving quality so that only 15% are defective:

The new percentage of guitars considered good enough to sell would be 100% - 15% = 85%.

Option 3: Reducing labor, materials, and overhead costs by 15%:

The new costs per guitar would be $39 - (15% of $39) = $33.15.

To know more about labor productivity

https://brainly.com/question/33441387

#SPJ4

The following steps make up the recombination DNA technology process  DNA extraction from genetic material DNA is cut in precise places. connecting DNA fragments. DNA insertion within the host cell. choosing and testing transformed cells.

DNA amplification is the final step. Through a procedure known as plasmid or vector transformation, the resultant rDNA is put into a bacterial cell. The plasmid dna will subsequently be replicated via in vivo procedures for natural DNA replication.

Cutting a gene from its natural place, inserting into a circular DNA fragment from either a bacterial cell, and afterwards transmitting the ring of DNA to cell of another organism are the steps involved in creating recombinant DNA molecules species.

To know more about DNA visit:

https://brainly.com/question/1674414

#SPJ1

Wastewater is water that contains the waste from homes and industries.

Wastewater refers to water that contains waste products. Waste water can also refer to water that have been used for several purposes and produced as a by-product.

The primary sources of waste water include:

Therefore, it can be concluded that waste water is water that contains waste from homes and industries.

Learn more about wastewater at: https://brainly.com/question/25085634

Convective clouds cannot go high enough to produce showers and visibility also greatly reduced due to the accumulation of dust and smoke particles.

Frontal Inversions are the inversions that is caused by a shallow "cold air" blowing in under warmer air. An inversion traps air pollutants, such as smog, close to the ground.

So we can conclude that convective clouds cannot go high enough to produce showers and visibility also greatly reduced due to the accumulation of dust and smoke particles.

Learn more about environment here: https://brainly.com/question/17413226

Answer:
Here is the answer!

Explanation:
I took the assignment.

Chinook salmons are extensively harvested as they are a food item for people who live in the area. In fact, they are one of the most valuable food sources for communities in the Pacific Northwest. The Chinook salmon is also known as king salmon, and is the largest species in the salmon family.

Chinook salmon are anadromous, meaning that they migrate from the ocean to freshwater rivers and streams to spawn. Chinook salmon have an important cultural significance to the Native American tribes that reside in the Pacific Northwest, where they have traditionally been an important food source for many years.

Chinook salmon are fished for their meat, which is high in protein and healthy fats. The fish is often smoked, grilled, or baked, and can be prepared in a variety of dishes. Chinook salmon are also used for their oil, which is high in omega-3 fatty acids and is used for nutritional supplements and pharmaceuticals.

n conclusion, Chinook salmons are extensively harvested and are an important food item for people who live in the area. The fish are high in protein, healthy fats, and omega-3 fatty acids, making them a valuable food source for many communities in the Pacific Northwest.

For more such questions on salmons, visit:

https://brainly.com/question/30093514

#SPJ8

Photosynthetic rate incrases steadiky as light level increse

Photosynthesis is defined as a process in which solar energy is captured and organic molecules are produced. This process is fundamental for the survival of life on the planet and is the main way in which energy enters the biosphere.

Photosynthesis takes place in chloroplasts. Chlorophyll and carotenoids are arranged in the thylakoids of chloroplasts in units called photosystems. Two steps can be observed in photosynthesis: light reactions and carbon fixation reactions. At the end of photosynthesis, carbohydrates are produced.

The breakdown of glucose occurs to generate ATP. In organisms without mitochondria, such as bacteria, respiration takes place in a structure called a mesosome. This process uses glucose and oxygen and produces ATP, carbon dioxide and water.

Learn more about Photosynthesis in brainly.com/question/1388366

#SPJ1

Answer:

B. Animalia, Chordata, Mammalia

Explanation:

Web

Cred not mine

Answer:  The correct answer is Animalia, Chordata, Mammalia

Explanation:  This answer has been confirmed correct.

The size of the population of bacteria at the end of the 2-hour time period is 64. So the answer is option 3.

If a population of bacteria reproduces by binary fission every 20 minutes, then the number of bacteria will double every 20 minutes.

In 2 hours (which is 120 minutes), there are 6 intervals of 20 minutes. Therefore, the number of bacteria will double 6 times.

Starting with 1 bacterium, the number of bacteria will be:

After 20 minutes: 2

After 40 minutes: 4

After 60 minutes: 8

After 80 minutes: 16

After 100 minutes: 32

After 120 minutes: 64

Therefore, the size of the population of bacteria at the end of the 2-hour time period is 64. So the answer is option 3.

Learn more about bacteria Visit: brainly.com/question/6941760

#SPJ4

Correct Question:

Starting from a single individual, what is the size of a population of bacteria that reproduce by binary fission every 20 minutes at the end of a 2-hour time period? (assume unlimited resources and no mortality.) group of answer choices

1. 16

2. 32

3. 64

4. 128

5. 8

Answer: Move

Explanation:

The idea that blood vessels in the face send temperature information to the brain, affecting the emotion we feel, is known as the facial feedback hypothesis.  

Facial feedback hypothesis states that the emotional experience is affected by the facial expressions of oneself. If an individual smiles, it can actually make him/her happy. The role of skeletal muscles if given prevalence in this hypothesis.

Blood vessels are the tube like structures that perform the functions of transporting blood to the entire body. They can carry blood from heart to the different organs and vice versa. There are three types of blood vessels: veins, arteries and capillaries.

To know more about facial feedback hypothesis, here

brainly.com/question/28237099

#SPJ4

False. In the maturation of T cells, the thymus is involved. A small gland called the thymus, part of the lymphatic system, is responsible for the development and production of T-cells, a specific subset of white blood cells.

The T-cells contribute in the ability of your immune system to fight disease and infection. The majority of your T-cells are created in utero by your thymus gland. By the time you reach adolescence, all the T-cells you'll ever need will have been produced during childhood, which also includes the leftover T-cells.

The thymus gland is found in the upper chest, behind the breastbone (sternum). Between your lungs, it is located in the mediastinum, a part of the chest. Your thymus is situated directly above and just in front of your heart.

Learn more about thymus here:

https://brainly.com/question/1290607

#SPJ4

The smooth endoplasmic reticulum (SER) and the rough endoplasmic reticulum (RER) are involved in different processes within the cell, and their interaction depends on the cell's specific needs. the SER provides the RER with the lipids required for membrane synthesis.

The SER is responsible for lipid metabolism, whereas the RER is responsible for protein synthesis and folding. As a result, the SER provides the RER with the lipids required for membrane synthesis. The endoplasmic reticulum (ER) is a network of membranes that extends from the nucleus throughout the cytoplasm. It's divided into two types, the rough endoplasmic reticulum (RER) and the smooth endoplasmic reticulum (SER), which differ in their structure and function. The RER is studded with ribosomes, which give it a rough appearance. Ribosomes are involved in protein synthesis, and the RER is responsible for the production and folding of proteins. The SER, on the other hand, lacks ribosomes and appears smooth. The SER is involved in lipid synthesis, detoxification, and the storage of calcium ions. The interaction between the SER and RER within a cell is dependent on the cell's requirements. In certain cells, the RER may need lipids from the SER for the production of cell membranes. In such a situation, the SER will supply the RER with the required lipids. As a result, option 1 is the best predictor of how the SER and RER will interact within a cell.

learn more about rough endoplasmic reticulum Refer: https://brainly.com/question/32055272

#SPJ11

complete question: which of the following best predicts how the smooth endoplasmic reticulum (ser) and the rough endoplasmic reticulum (rer) will interact within a cell?

1. The SER will provide the RER with lipids for membrane synthesis.

2. The SER will transport materials around the cell for the RER to process.

3. The SER will provide the RER with proteins for folding and modification.

4. The RER will provide the SER with energy for processes

Answer:

Brains

Explanation:

the brain gives us the distinct quality that make us human and allows us to think about the future to be playful and creative

The pentose phosphate pathway is a highly regulated metabolic pathway that can be adjusted based on the cellular needs for energy and reducing equivalents.

The pentose phosphate pathway plays a crucial role in the production of ribose-5-phosphate which is essential for the synthesis of nucleotides and NADPH. The pathway is divided into two parts, oxidative and non-oxidative steps. The non-oxidative steps are directly involved in NADPH production and do not involve the generation of ATP, unlike glycolysis. When NAD+ levels are high, flux through the pentose phosphate pathway is increased due to allosteric regulation of glucose-6-phosphate dehydrogenase. However, if reducing equivalents derived from the pathway are high, glucose-6-phosphate is directed towards glycolysis.

Learn more about pentose phosphate pathway here:

https://brainly.com/question/16011166

#SPJ11

Genetic, phenotypic, and immunological approaches can all be used to differentiate between strains of bacteria. The correct answer is (d), all of the above.

Genetic approaches involve comparing the DNA sequences of different strains of bacteria. This can be done by sequencing the entire genome of each strain, or by sequencing specific genes that are known to vary between strains.

Phenotypic approaches involve looking at the physical characteristics of different strains of bacteria. This can include things like the shape and size of the bacteria, the color of their colonies, and their ability to grow under different conditions.

Immunological approaches involve using antibodies to identify different strains of bacteria. Antibodies are proteins that bind to specific molecules on the surface of bacteria. By using antibodies that are specific to different strains of bacteria, it is possible to identify which strain is present in a sample.

Each of these approaches has its own advantages and disadvantages. Genetic approaches are very accurate, but they can be expensive and time-consuming.

Phenotypic approaches are less expensive and time-consuming, but they are not as accurate as genetic approaches. Immunological approaches are very accurate and can be done quickly, but they require specialized equipment and reagents.

The best approach to use for differentiating between strains of bacteria will depend on the specific needs of the situation. If accuracy is the most important factor, then a genetic approach would be the best choice.

If speed and cost are more important, then a phenotypic approach would be a better choice. If accuracy and speed are both important, then an immunological approach would be the best choice.

To know more about strains of bacteria, refer here:

https://brainly.com/question/31849284#

#SPJ11