What is delta made of

Answers

Answer 1

Answer:

sediment, typically silt, that is eroded into a river

Explanation:

Deltas are land forms created at or near the mouths of rivers. They are caused by sediment, typically silt, that is eroded into a river and carried to its mouth, where the sediment is deposited.

Answer 2

Answer:

When I think of the word 'delta' I typically think of mud, silt, and sand (or, ahem, clastic detritus) as the construction material.

Explanation:

Deltas are accumulations of sediment that form where a river meets a standing body of water. Over time a depositional feature builds out into the body of water. When I think of the word 'delta' I typically think of mud, silt, and sand (or, ahem, clastic detritus) as the construction material.


Related Questions

political social economical and technological configuration that support social border trade ​

Answers

A political, social, economic, and technological configuration that supports social border trade would involve various factors working together. Here's a breakdown of each aspect:

1. Political Configuration:

  - Bilateral Agreements: Governments should establish and maintain bilateral agreements that facilitate cross-border trade, focusing on reducing barriers, streamlining customs procedures, and harmonizing regulations.

  - Regulatory Framework: Governments need to create a favorable regulatory framework that encourages and supports social border trade, ensuring transparency, fairness, and legal protection for participants.

  - Border Infrastructure: Adequate investment in border infrastructure, including customs checkpoints, roads, bridges, and communication networks, is crucial for efficient trade flows and connectivity.

2. Social Configuration:

  - Cultural Exchange: Encouraging cultural exchange and understanding between communities on both sides of the border can foster trust, cooperation, and mutual benefits in social border trade.

  - Cross-Border Cooperation: Promoting collaboration between local communities, businesses, and organizations across the border can lead to shared economic development, improved social ties, and increased opportunities for social border trade.

3. Economic Configuration:

  - Special Economic Zones: Establishing special economic zones or free trade areas near the border can attract investment, create job opportunities, and provide incentives for businesses engaged in cross-border trade.

  - Tax and Tariff Policies: Implementing favorable tax and tariff policies, such as reduced customs duties or exemptions, can encourage social border trade by

define the term social change and state TWO social changes you may encounter as a student ​

Answers

Answer:

Answer Below ↓

Explanation:

Social changes are differences that may appear in environments or interactions that you have with others. One social change that someone may encounter as an employee is a job promotion. A social change you may have as a student is a grade change.

What has changed so that more businesses in the recent past have started allowing their employees to work from their home?
Less time off due to illness as workers need not be exposed to the elements getting to and from the workplace
Improvements in communication and networking technology
Improved productivity when people do not have to interact with one another in the workplace
High gas and transportation costs

Answers

High gas and transportation costs

Working from home has become an accepted practice due to the advancement in internet access and communication technology.

Many businesses are supporting work from home by making the necessary investments. If put into practice correctly, working from home is effective.

The pandemic helped in overcoming the fear of loss of productivity while working from home as during the pandemic, we saw that employees could work on their own. Some studies indicated that work from home option increases job satisfaction among employees. They believe that flexibility is the biggest benefit while working from home.

To know more about work from home;

brainly.com/question/14739387

characteristic of Japanese Christianity.

Answers

Answer:

Christianity is a minority religion in Japan as the number of Christian people is very less when compared to Japanese people. Their Christianity includes syncretism because their rituals are dominated by Japanese culture so there may be the use of Buddha traditions. Many Japanese Christians have a strong commitment to pacifism, stemming from Japan's experiences during World War II and its aftermath. This has led to a focus on social justice and non-violent activism in many Christian communities.Their community is very small since there is only 1% of the Japanese population. Aggregation of new members is difficult but the community tends to be very strong due to more quality.They also develop interfaith since they incorporate Buddha tradition into their rituals. So they are open to explore other religions.

What did this type of testimony help prosecutors to
prove?
the Holocaust and other war crimes were well-
known.
the Holocaust and other war crimes were not well-
known.
the mistreatment of prisoners of war was well-
known.
the mistreatment of civilians in labor camps was not
well-known.

Answers

You need to add context so we can answer you.

Answer:

its A u dont need a context

Explanation:

What is the major difference between open and closed primaries?
*
4 points
In a closed primary, party leaders discuss issues and choose candidates.
In a closed primary, voters must be registered as a party member.
In a closed primary, voters do not have to be registered as a party member.
In a closed primary, voters can select self-nominated candidates.

Answers

Answer: • While both open and closed primaries are designed to narrow down the choice of candidates of a party, to stand in the next general elections against the nominee of the other party, anyone can take part in an open primary irrespective of his party affiliations.

• On the other hand, only registered members of a political party can take part in a closed primary.

• There are states with open primaries while there are many states where only closed primaries are held.

Explanation: Closed primaries: There are many states where closed primaries are held. These are elections within the party to narrow down the choice of candidates for the general elections where the winning party candidate fights against the nominee of the other party. The distinguishing feature of a closed primary is that only those who are registered members of a party are allowed to take part in these elections. A voter has to state his preference for the party before he is asked to vote in the primary. You are denied permission to vote in the closed primary of a party if you are not a member of that party.

Open primaries: Open primary is a ballot open to people with all affiliations. Thus, whether you are a Republican, a Democrat, a Libertarian, or even a communist, you have the right to vote in the primary election of any party you desire. This means that if it is the Republican party that is deciding upon its candidate, to fight in the next general elections for a particular position or seat, you can indicate your preference no matter whether you are a registered Republican or not.

why did russia fall behind many european coutries in the 1800s
A. too much dependence on agriculture
B. increased focus on gaining land in Asia
C. failures of the communist-run economic system
D. unwillingness to trade with Europe

Answers

Answer:it’s c

Explanation:

Answer:

I think d

Explanation:

2. What does "resent" mean? Why do many Muslims in Saudi Arabia
"resent" U.S. troops being in their country?

Answers

Answer:

to feel bitterness or dont really want them to be there.

Explanation:

The difference between race and ethnicity?

Answers

Answer:

Race is I.e : Asian Korean African

Ethnictcy is: muslim ( Arab) like that

Explanation:

NO LINKS
J. L. Mackie argued against free will theodicy by claiming human suffering is an illusion.
Group of answer choices

True

False

Answers

Answer:

true

Explanation:

The Free Will Theodicy (FWT) attempts to defeat the Argument from Evil by claiming that the suffering of the innocent (SOI) is justified by the existence of free will (FW).This choice outcome undermines the FWT's contention that FW adequately justifies the quantity and severity of the SOI in this world.

Finance sector is a very sensitive field. Do you agree? Give reasons.​

Answers

Answer:

Yes I agree; because It generates local savings, which in turn lead to productive investments in local business. Furthermore, effective banks can channel international streams of private remittances. The financial sector therefore provides the rudiments for income-growth and job creations..

nepal has never been under any foreign rule justify the statements ​

Answers

Answer:

Nepal has never been under any foreign rule, therefore, Nepal doesn't have an independence day. Nepal is a peaceful country as it is the land of Lord Buddha.

a 27-year-old woman presents to your office with complaints of pain and discomfort. she tells you that she has seen numerous doctors and none of them have been able to help her. her symptoms today include nausea, irregular menses, weakness in her legs, headache, dysuria, dyspareunia, and back pain. she would like you to do a ct scan to determine the cause of her complaints. which of the following is the most likely diagnosis?

Answers

In the given situation somatic symptom disorder is the most likely diagnosis for the 27-year-old woman.

What is somatic symptom disorder?

A diagnosis of somatic symptom disorder is made when a person places a great deal of emphasis on bodily symptoms like pain, fatigue, or shortness of breath to the point where it causes them great suffering and/or functional difficulties.

The person overreacts to the physical symptoms in their thoughts, feelings, and behaviors.

either more specific symptoms, such as pain or shortness of breath, or more generic ones, like weakness or exhaustion.

Unconnected to any known medical reason, connected to a disease like cancer or heart disease but more severe than usual, or unrelated to any known medical cause.

So, the 27-year-old woman's most likely diagnosis is a somatic symptom condition.

Therefore, in the given situation the somatic symptom disorder is the most likely diagnosis for the 27-year-old woman.

Know more about somatic symptom disorder here:

https://brainly.com/question/28240605

#SPJ4

Correct question:

A 27-year-old woman presents to your office with complaints of pain and discomfort. she tells you that she has seen numerous doctors and none of them have been able to help her. her symptoms today include nausea, irregular menses, weakness in her legs, headache, dysuria, dyspareunia, and back pain. she would like you to do a ct scan to determine the cause of her complaints. What is the most likely diagnosis?

The biological theory of emotional expression claims that differences in brain chemistry account for the difference in how emotions are expressed and detected. True or false?

Answers

While differences in brain chemistry can play a role in emotional expression and detection, the biological theory of emotional expression does not solely rely on this explanation. Hence the statement is False.

This theory takes into account multiple biological factors, such as facial muscles, vocal cords, and autonomic nervous system responses, that contribute to emotional expression and perception. Additionally, environmental and cultural factors also play a crucial role in shaping how emotions are expressed and detected.

Therefore, it is important to consider a range of biological, psychological, and social factors when exploring emotional expression and perception.

Learn more about biological theory here

https://brainly.com/question/31356058

#SPJ1

Mention THREE benefits of being able to effectively communicate with your teachers.​

Answers

Answer:

Creates better relationships.

Helps handle problems better.

Builds trust.

omar is asked to report what he sees in an ambiguous picture and is asked to provide story about what is happening in the picture. omar is most likely being given the:

Answers

Omar is most likely assigned the task of providing a description of the photograph as well as a narrative or story about it.

What exactly is an ambiguous image?

To generate doubt, visual shapes known as ambiguous images or reversal figures employ graphical similarities and various other features of how the visual system interprets two or more separate image patterns.

This can include finding particular objects and people in the photograph, assuming their actions and intentions, and assessing the scene and any other relevant information. In order to develop a credible and cohesive narrative, Omar may need to engage his critical processing abilities and base his educated guesses on the indications in the image.

Learn more about ambiguous picture here:

brainly.com/question/29892025

#SPJ1

Explain how productivity and specialization relate to you as you enter the free market.

Answers

Answer:

Productivity and specialization are both quite related to an entrance to the job market in a free market system.

Productivity is one of the most important viariables when entering the labor market. This is because wages depend mostly on the productivity of workers. The more productive you are, the higher your wage is likely to be.

Specialization is another important aspect. People who are highly specialized tend to be very educated and very productive, this means that a high degree of specialization is also predictive of a high wage.

Pope Gregory VII and Emperor Henry IV disagreed about a. how serfs and peasants should be treated in feudal society. b. who should select bishops. c. where in Europe the church headquarters should be located. d. who could excommunicate people. Please select the best answer from the choices provided A B C D

Answers

Answer: Who should select bishops

Explanation:

I took a test on it and got it right

Hope this helps:)

Answer:B the answers B

Explanation:

"Choose one of the following countries—Japan, Sweden, Russia, Mexico, Germany, Canada, China, or England—and prepare an economic report comparing the United States to the country you selected."

Answers

Answer:

Comparing Sweden economy with USA.

Explanation:

The economy of Sweden is economically economically free. The Sweden economy has a lower score than US government. Bu has an higher composites of economic freedom and has an open market system.

insightful reasoning for why substance abuse is happening.

Answers

Answer:

Social factors that contribute to increased risk for adolescent substance use include deviant peer relationships, popularity, bullying, and association with gangs.

Explanation:

Does the number of foreclosures in the early 2000s support the statement that the American economy has a free financial system? Explain why or why not.

Answers

Answer:m yes

Explanation: yes because 2000's the president had to let african american citizen.

People who brought down the Assyrians twice

Answers

Assyria was at the height of its strength, however persistent difficulties controlling Babylonia could quickly develop into the main conflict. at the give up of the 7th century, the Assyrian empire collapsed under the assault of Babylonians from southern Mesopotamia and Medes, newcomers who had been to establish a state in Iran.

In October or November 615 BC, the Medes below King Cyaxares invaded Assyria and conquered the region around the city of Arrapha in guidance for a notable very last campaign in opposition to the Assyrians.

Assyrians are an ethnic group indigenous to Assyria, a place positioned inside the middle East. some Assyrians self-pick out as Syriacs, Chaldeans, or Arameans. they're the audio system of the Neo-Aramaic department of Semitic languages as well as the number one language of their international locations of the house.

Learn more about Assyrians here:

https://brainly.com/question/824710

#SPJ9

which part of africa is wider?The nourther or the south​

Answers

Answer

In fact Africa takes up a fifth of the earth's landmass. It's approximately 5000 miles from Tunisia to South Africa (north to south) and about 4,600 miles from east to west at its widest point.wer:

Explanation:

googled it

short essay on what you like about RNB music? Or on lauryn hill

Answers

R&B music is captivating, with its soulful melodies, heartfelt lyrics, and smooth grooves. Lauryn Hill's talent and authenticity shine.

Lauryn Hill is a highly influential artist known for her contributions to R&B music. Her unique blend of soulful vocals, introspective lyrics, and musical versatility captivates listeners and sets her apart. One of the aspects I appreciate about Lauryn Hill is her ability to express raw emotions through her music. Her songs often delve into personal experiences, social issues, and introspection, resonating with audiences on a deep level. Additionally, Lauryn Hill's powerful voice and skilled songwriting create a timeless appeal that continues to inspire new generations of artists. Her album "The Miseducation of Lauryn Hill" is a masterpiece, showcasing her talent and versatility. Whether it's her soulful ballads or energetic hip-hop tracks, Lauryn Hill's music leaves a lasting impact, reminding us of the power of artistic expression and the importance of authenticity.

For more such questions on R&B music:

https://brainly.com/question/29427183

#SPJ8

what is the unique character of moral judgement and decision making​

Answers

I don't know to be honest with u

Explanation:

to be honest with you

What important Federalist idea is expressed in this excerpt from the Federalist Papers?

Answers

The important Federalist idea expressed is the necessity of a strong, centralized government to maintain order and unity.

The excerpt from the Federalist Papers conveys a crucial Federalist concept, emphasizing the need for a robust, centralized government to effectively maintain order and ensure national unity.

The Federalists, led by figures like Alexander Hamilton, James Madison, and John Jay, believed that a strong central authority was essential to address issues such as economic stability, defense, and diplomacy, which individual states might struggle to handle on their own.

Their ideas helped shape the US Constitution, creating a government structure that would balance state autonomy with a powerful federal government capable of uniting the nation.

For more such questions on Federalist, click on:

https://brainly.com/question/985210

#SPJ11

What is the capital of Guyana?
Sao Paulo
Maracaibo
Georgetown
Caracas

Answers

It is geowgetown UwU
The answer is C. Georgetown!

Is Biden's US government going to default on its debts again? Will this affect our lives?

Answers

It is difficult to predict with certainty whether the United States government will default on its debts again. If the US government were to default on its debts, it could certainly affect our lives in a number of ways. It could lead to higher inflation, reduced access to credit, and increased unemployment and economic instability. Additionally, it could impact global trade and international relations, which could have far-reaching consequences beyond just the US economy.  

Who judge trails in ancient Athens

Answers

Answer:

The governor.

Explanation:

I'm 90% sure of myself that it's is right.

in the context of gardner's theory of multiple intelligences, levi would score high on____intelligence.

Answers

Levi would have a high level of interpersonal intelligence according to Gardner's hypothesis of multiple intelligences.

As a result of his theory that each person has a unique set of aptitudes, Howard Gardner divided intelligence into nine categories.

1. Well-developed verbal abilities and sensitivity to the sounds and meanings of words are referred to as verbal-linguistic intelligence.

2. The ability to discern logical and numerical patterns and to think conceptually and abstractly is known as logical-mathematical intelligence.

3. A well-developed ability to properly and abstractly visualize space for navigation is called spatial-visual intelligence.

4. Bodily-Kinesthetic Intelligence is the capacity to regulate movement and manipulate objects deftly.

5. The capacity to create pitch, timber, and rhythm is a sign of musical intelligence.

6. The capacity to communicate with and relate to others is known as interpersonal intelligence.

7. Being able to be self-aware and comprehend oneself—intrapersonal intelligence

8. Naturalist intelligence is the capacity to recognize and classify elements of nature.

9. Existential intelligence is the ability to understand and be sensitive to human existence.

To learn more on Gardner's hypothesis of multiple intelligences:

https://brainly.com/question/4158015

#SPJ4

Other Questions
Prior to the invention of a revolutionary means of travel, people had to make long, dangerous journeys to cross parts of the country. Due to this development, society was revolutionized as travel became safe and efficient. Which is most likely the first invention that changed society so much? A. the airplane B. the steam engine C. the car D. the train President woodrow wilson on april 2, 1917 went before a joint session of congress to ask for a declaration of war on germany:____. Your firm has sales of $47,000, current assets of $5,100, current liabilities of $6,200, net fixed assets of $51,500, and a profit margin of 5 percent. The firm has no long-term debt and does not plan on acquiring any. The firm does not pay any dividends. Sales are expected to increase by 7 percent next year. If all assets, short-term liabilities, and costs vary directly with sales, how much additional equity financing is required for next year What is the approximate dihedral angle between the two chlorine atoms in the diequatorial conformation of trans-1,2-dichlorocyclohexane? __________, which in turn had a great influence on the tenets of the high renaissance emphasized harmony, order, reason, intellect, objectivity, and formal discipline. Energy from ___________ powers the water cycle and allows water to move around the earth.the earth's coregravitythe sunnatural disasters Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X the term describes treatment in which a body part is removed or its function is destroyed. this type of procedure is frequently used to treat prostate cancer. Consider the following regression model, Y_i= _0 + _1X_i + e_i, where the variance of the error term is var(e_i) = ^2(X_1)^2. Note that ^2 is an unknown constant. Further, assume that the model satisfies all of the assumptions of the Gauss-Markov Theorem except for heteroscedasticity. a) Formulate a Weighted Least Square (WLS) regression for this model that provides the BLUE of the model coefficients. (30 marks) b) Demonstrate that the error term of your transformed model is homoskedastic. (30 marks) c) How do the estimated coefficients of your transformed model transform into estimates of your original model? (40 marks) show that one arch of a cycloid generated by a circle of radius r has length 8r Select the correct navigational path to hide a worksheet. Click the tab on the ribbon to the Cells gallery. Select and use that drop-down menu to select . Then Hide Sheet. No pertenece Identify the word that doesn't belong in each group.1. iglesia gimnasio museo golf2. baloncesto tenis parque hockey3. bicicleta patines pelota equipo4. lugar peridico revista correo electrnico A jewelry shop is offering a percent discount on the original price of a jade pendant. The original price of the pendant was $200. Let D represent the percent discount written as a decimal. Write an equation to find the discount price, y dollars of the pendant. according to the five factor model (ffm) or ocean model of personality, which of the following dimensions primarily involves behaviors that are highly likely to be exhibited in group settings and are generally concerned with getting ahead in life? group of answer choices neuroticism Match the direct object pronouns with their English equivalents los lotelanoslasme (Word bank)- It; him; you (formal) Them; you (formal/feminine) Them; you (formal/ masculine It;her;you (formal) me Wayne took his family out to dinner. The cost of the food was $42.50. Wayne decided to give a 30% tip because of excellent service. The tax was 4% of the cost of the food. What was the total amount the meal cost him? Evaluate 48/6 - 10/3, 4 1/3, 9 1/3, 4 2/3, 12 2/3 Sixteen students in a drama club want to attend a play. The ticket price for each student is $35. The transportation and meals for everyone is $960. How much is the total cost for all students to attend the play? (Including the ticket price, transportation and meals High-end levi's jeans that are produced in the united states but then sold to stores in china and france are an example of us _____. Which equation has infinitely many solutions? a 12 + 4x = 6x + 10 - 2x b 5x + 14 - 4x = 23 + x-9 cc X + 9 -0.8x = 5.2x + 17-8 d 4x-2x = 20