What is the relationship between the 2 processes cellular respiration and photosynthesis? Use vocabulary words like autotroph, heterotroph and photosynthetic.

Answers

Answer 1
The products of cellular respiration are the reactants of photosynthesis and the products of photosynthesis are the reactants of cellular respiration. Photosynthesis transforms solar energy into chemical energy and cellular respiration transforms chemical energy into USABLE energy currency. (Hope that helps)

Related Questions

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)
Group of answer choices

weight

hair texture

attached or unattached earlobes

eye color

Answers

Answer:

Hair texture, attached/unattached earlobes, eye colors.

Explanation:

Weight is gained through the individual themselves as they grow and develop. There is no determined weight with genes.

Answer:

I hope this helps.

Explanation:

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)Group

1.Different protists use cilia, _______, or pseudopodia to move.
2.Green algae are closely related to plants, and _______ is what gives them their green color.
3.Protists in the genus plasmodium must live in host cells and harm their host cells, providing an example of a _______ relationship.
4..Why have scientists recently rejected classifying protists in their own kingdom?
5..What are the three main ways that protists can move?
6.The eukaryote that causes red tide is known as what?
7.The organisms that push carbon to the bottom of the ocean are known as what? Why is this important to the ecosystem?
8.How is the endosymbiotic theory used to support the emergence of Eukaryota?

Answers

Answer:

flagella

chlorophyll

parasitic

Scientists have recently rejected "Protista" as a kingdom because as evolutionary and molecular knowledge continues to increase, the relationships among organisms are strengthened that weren't previously considered. It continues to be found that many protists don't share common ancestry with other protists that don't exclude other groups, such as plants, animals, and fungi. Protists had been previously classified through what they are not: plants, fungi, or animals. They share no characteristics that aren't also shared by "nonprotists."

The three main ways protists can move are through cilia, flagella, and pseudopods. All of these structures help protists to move in different ways through their environment.

The eukaryote that causes red tide is known as a dinoflagellate.

The eukaryotes that push carbon to the bottom of the ocean are known as diatoms. This is important to the ecosystem because it lowers the overall carbon dioxide levels in the air and buries the carbon deep in the sea.

The endosymbiotic theory posits that eukaryotes emerged when one or more prokaryotic cells ingested another prokaryotic cell, leading to the eventual eukaryotic cell.

Explanation:

Answer:

1. flagella

2. chlorophyll

3. parasitic

4. Scientists have recently rejected "Protista" as a kingdom because as evolutionary and molecular knowledge continues to increase, the relationships among organisms are strengthened that weren't previously considered. It continues to be found that many protists don't share common ancestry with other protists that don't exclude other groups, such as plants, animals, and fungi. Protists had been previously classified through what they are not: plants, fungi, or animals. They share no characteristics that aren't also shared by "nonprotists."

5. The three main ways protists can move are through cilia, flagella, and pseudopods. All of these structures help protists to move in different ways through their environment.

6. The eukaryote that causes red tide is known as a dinoflagellate.

7.The eukaryotes that push carbon to the bottom of the ocean are known as diatoms. This is important to the ecosystem because it lowers the overall carbon dioxide levels in the air and buries the carbon deep in the sea.

8.The endosymbiotic theory posits that eukaryotes emerged when one or more prokaryotic cells ingested another prokaryotic cell, leading to the eventual eukaryotic cell.

Explanation:

NEED HELP!!! WILL GIVE BRAINLIEST!! <3

NEED HELP!!! WILL GIVE BRAINLIEST!! &lt;3

Answers

Answer:

pollution

Explanation:

i guess I can only think of one

what is a non example of desublimation

Answers

Answer: Sodium sulphate

Explanation: Sodium sulphate is not an example of sublimate substance. Sublimation is the process in which there is a change of state directly from solid to gas without changing into a liquid state.

Answer:

Desublimation is a phase transition in which a gas changes directly to a solid without passing through an intermediate liquid phase.

It is an exothermic phase change that occurs at temperatures and pressures below a substance’s triple point in its phase diagram.

Desublimation is also called deposition.

Desublimation is caused by a drastic loss in thermal energy from the surrounding gas due to the presence of a much cooler surface.

For example, frost formation occurs on window surfaces during the winter seasons.

This window is at a much cooler temperature, this makes the water vapor in the surrounding air to lose enough thermal energy and change directly into solid which we see as frost during winter.

The endosymbiotic theory proposes that eukaryotic cells arose from living communities formed by the merging of prokaryotic organisms and their hosts.



Which of the following is the best evidence to support the endosymbiotic theory?

Pilihan jawaban
Mitochondria and chloroplasts contain DNA similar to bacterial DNA

Both prokaryotic and eukaryotic organisms require oxygen in order to use energy

Bacteria, mitochondria, and chloroplasts all divide by mitosis, while the cells containing them divide by binary fission

Bacteria and mitochondria contain many features that are similar to each other but different from those of chloroplasts

Answers

Mitochondria and chloroplasts contain DNA similar to bacterial DNA is the best evidence to support the endosymbiotic theory.

According to the endosymbiotic theory, eukaryotic cell organelles like mitochondria and plastids originated from free-living prokaryotes. According to the information at hand, Margulis' theory that the eukaryotic cell evolved first was supported by mitochondrial endosymbiosis.

Endosymbiosis is a type of symbiosis in which the symbiont resides inside the body of its host; this symbiont is referred to as an endosymbiont in this situation.

Because earlier researchers lacked the technology to perform a really fair test of the endosymbiotic hypothesis, there was no conclusive evidence in support of the concept.

To learn more about Endosymbiotic visit: https://brainly.com/question/583859

#SPJ4

what is photosynthesis ???​

Answers

Answer:

plants feed themselves by manufacturing food by absorbing light as energy

Answer:

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of suga

Match the component of cellular respiration with the object that closely mirrors its function.
1. Battery A.Bloodstream
2. Delivery Truck B. Glucose
3. Poison C. Mitochondria
4. Raw material D. ATP
5. Factory E. Carbon Dioxide​

Answers

(1/D)
(2/A)
(3/E)
(4/B)
(5/C)
I'll say 1 and 4 was a little tough because they are both are energy but I hope that I put them in there rightful spot!

The battery is like ATP, Delivery Truck is like the bloodstream, poison is like carbon dioxide, raw material is like glucose and the factory is like mitochondria.

What is cellular respiration?

Through the process of cellular respiration, organisms mix oxygen with food molecules, directing the chemical energy contained in these substances toward life-sustaining processes while excreting carbon dioxide and water as waste.

Foods are broken down by microorganisms that do not require oxygen in a process known as fermentation.

Adenosine triphosphate (ATP), an energy-rich compound that absorbs the chemical energy obtained from the breakup of carbohydrates and fats and releases it to fuel other cellular processes, is one goal of the degradation of foodstuffs. ATP is created when the energy contained in chemical bonds is converted from one form to another.

The mitochondria, which are highly organized rod-shaped compartments, are where the enzymes that catalyze the individual processing steps in respiration and energy conservation are found in eukaryotic cells, which are defined as any cells or organisms that obtain a clearly defined nucleus and membrane-bound organelles.

Therefore, the battery is like ATP, Delivery Truck is like the bloodstream, poison is like carbon dioxide, raw material is like glucose and the factory is like mitochondria.

Read more about cellular respiration, here

https://brainly.com/question/13721588

#SPJ5

Some people think that observed changes are just the
usual year-to-year variations. They remember the 1930s
and 40s, when winters were so mild and dry that they
rode scooters on the streets of Toronto. How would you
respond to them?

Answers

I would respond to them by saying that climate change was the reason why winters were no longer so mild and dry that they were able to ride scooters on the streets of Toronto.

What is Climate change?

This is referred to as long-term shifts in temperatures and weather patterns which has occurred due to human activities and its impact on the ecosystem.

Technological advances have led to the use of fossil fuel such as coal, petrol etc in other to power them up and examples include the invention of cars and industries which produce things.

There is also the issue of emission of greenhouse gases such as carbon dioxide , methane etc in various sectors and the lack of trees has also led to a high concentration in the atmosphere which is therefore why the issue of climate change will be used to respond.

Read more about Climate change here https://brainly.com/question/24316365

#SPJ1


What BEST describes the role of water molecules in the chemical reactions of photosynthesis?
Water molecules are an intermediate c. Water molecules are an input of
of photosynthesis, they absorb light photosynthesis, they split apart and
and pass the energy to chlorophyll supply electrons to chlorophyll to
make glucose
b. Water molecules are an intermediated Water molecules are an output of
of photosynthesis, they are part of the photosynthesis, they are released at
electron transport chain
the end of the electron transport chain

Answers

Answer:

The options to this question is unclear. However, the question will be answered comprehensively.

Water molecules are an input of photosynthesis; they split apart and supply electrons to chlorophyll to make glucose.

Explanation:

Photosynthesis is the unique process through which green plants manufacture their food (glucose). This photosynthetic process occurs in two stages viz: light dependent and light independent stages. The light dependent stage, which occurs in the thylakoid membrane of the chloroplast, involves the synthesis of NADPH and ATP.

Water molecules are reactants (inputs) of this light stage, where they are split by the energy absorbed by chlorophyll in a process called PHOTOLYSIS. Water molecules get split into hydrogen ions (proton), oxygen gas and electrons. The electrons are accepted by NADP+ while the protons are used to build a proton pump for the synthesis of ATP. Both NADPH and ATP are used in the next stage to make glucose.

Which of the following is a benefit of nonrenewable energy?

A.It costs less than some renewable options.
B.It uses man-made and natural resources.
C.It is unlimited or quickly replenished.
D.It is from clean energy sources.

Answers

Answer:

B. It uses man-made and natural resources.

Explanation:

Sorry if incorrect

Non-renewable energy uses man-made and natural resources. So, the correct option is B.

What are Non-renewable energy?

Natural resources that cannot be easily replenished through natural means at a rate quick enough to stay current with use are considered non-renewable resources. Fossil fuels made of carbon are one instance. With the use of pressure and heat, the original biological matter transforms into a fuel like petrol or oil.

Non-renewable energy is produced using finite resources that cannot be replenished at a rate that matches the rate of use. To put things in perspective, there won't be any more non-renewable energy sources in our lives—or, more precisely, in many human lifetimes.

The majority of non-renewable sources of energy are fossil fuels, such as coal, natural gas, and petroleum and crude oil; however, nuclear fuel, which is primarily used to generate electricity, is also typically categorized as non-renewable.

Therefore, the correct option is B.

Learn more about non-renewable source, here:

https://brainly.com/question/30178642

#SPJ2

parent one and parent 2, I NEED HELP PLEASEEEEEEEEE, I WILL GIVE BRAINLEST I NEED HELPP, URGENTTTTTTTTT, ​

parent one and parent 2, I NEED HELP PLEASEEEEEEEEE, I WILL GIVE BRAINLEST I NEED HELPP, URGENTTTTTTTTT,

Answers

Answer:

The correct answer would be :

rr (parent I) × rr (parent II)

Explanation:

In this given question there are two traits present in the corns that are red kernels and yellow kernels. It is also given that the yellow kernel is dominant over the yellow kernels.

In the provided Punnett square and on our knowledge we know that the recessive trait which is the yellow kernel only expresses itself when both the genes of the kernel have recessive gene r.

In the heterozygous cross, there would be only 50% chances of the kernels of an ear of corn to produce yellow kernels.. There is only one possible condition which is:

rr cross with rr

     r      r

r     rr     rr

r     rr     rr

All kernels in this condition will be yellow.

If purple flowers (P) are dominant to white flowers (p) in pea plants, what wouldthe phenotype be of an individual with the genotype: homozygous dominant?O PurpleWhiteO PinkO Red

Answers

If purple flowers (P) are dominant to white flowers (p) in pea plants, the phenotype of an individual with an homozygous dominant genotype (PP) would be: Purple.

Being homozygous, there is only one possible allele to be expressed and define the characteristics of the trait, independently of the relationship between alleles.

How will your participation in the STEM Core Program help you meet your education and career goals? *

Answers

Answer:

STEM training helps students develop critical thinking skills.

Explanation:

Curiosity and problem-solving are at the root of success in the professional world, not only in STEM, but in all industries. But particularly in STEM fields, where change is the only constant, students must learn to embrace a difficult challenge and devise a creative solution.

Describe the purpose of DNA
replication. In other words, what is it and
why is it important?
3 sentences or more please

Answers

Answer:

DNA replication is a process by which a single DNA molecule is copied to create two identical molecules. This is an essential process for cell division, growth, and repair of damaged DNA. DNA replication plays an important role in the passing of genetic information from one generation to the next, and it is also important for maintaining genetic stability by repairing any mutations that occur in the DNA. Additionally, DNA replication is necessary for cells to produce proteins, as the process involves copying the genetic instructions encoded in the DNA so that the proteins can be synthesized.

Myofibrils are __________.
a) the basic contractile units of skeletal muscle tissue
b) the contractile proteins located within a muscle cell
c) the boundaries of individual sarcomeres
d) specialized contractile organelles found in muscle cells
e) none of the listed responses is correct.

Answers

Answer: Option B

Explanation:

Myofibrils are very fine contractile fibers which extends in parallel to the columns along the length of the striated muscles fibres.

They are made of thick and thin myofilaments because of which the muscles appear striped.

The thick filaments in the muscles are composed of actin along with two other muscle protein known as tropomyosin and troponin. They help in contraction of muscles.

Find the missing side.
14
7
= [?]
X =
Round to the nearest tenth.
Enter

Find the missing side. 14 7 = [?] X = Round to the nearest tenth. Enter

Answers

The value of the missing side in the triangle that we have in the question is 12.

What is the Pythagoras theorem?

Numerous disciplines, including mathematics, physics, engineering, and architecture, frequently use the Pythagorean theorem. It offers a way to determine side lengths that are unknown or determine whether a triangle is a right triangle. It also forms the basis for trigonometry, the study of the connections between triangles' angles and sides.

Using;

\(c^2 = a^2 + b^2\\x^2 = 14^2 - 7^2\)

x = 12

Learn more about Pythagoras theorem:https://brainly.com/question/31658142

#SPJ1

SI Unit Conversion .

SI Unit Conversion .

Answers

Answer and Explanation:

2. 66420000 (multiply the length value by 100000)

3. 0.0419 (divide the length value by 1000)

4. 600000 (multiply the volume value by 1000)

5. 0.099 (divide the mass value by 1000)

6. 0.145 (divide the length value by 10)

7. 57683000 (multiply the mass value by 1000)

8. 3546240 (multiply the length value by 1000)

9. 8.45e-6 (divide the volume value by 1000)

10. 0.0013499 (divide the mass value by 1000)

What is the biggest error, methodologically, in the following scientific study? "The goal of the study was to determine whether the ebola virus is as deadly in rhesus monkeys as it is in gorillas. I took a sample of four healthy rhesus monkeys and four healthy gorillas. The animals were a random mixture of sexes and ages. I arranged eight cages so that each animal would be in a separate cage, and I made sure there would be no contact among the cages that would allow transmission of the virus. Then I obtained a sample of the ebola virus from the National Institute of Infectious Diseases and injected all the monkeys and gorillas with the same size dose. At the end of four days, I noticed that all the gorillas were dead but only one of the monkeys was dead. An autopsy revealed that three of the four gorillas had died of ebola fever but that the fourth, nicknamed Curious George, had died of internal bleeding after swallowing the small pair of scissors that were left within reach of its cage. The dead monkey had died of ebola fever. At the end of two months there were no more deaths. I concluded that my dosage of the ebola virus is three times as likely to be deadly to gorillas as it is to rhesus monkeys, but I recommended repeating the study to see if the percentages of deaths due to ebola fever remained steady over a wide range of dosages of the virus."

Answers

Answer:

The sample obtained for the study is not enough. Also, a control group is not established thus making the study erroneous.

Explanation:

The total sample size of 4 specimens from each of the two groups does not qualify as an appropriate sample size for the generalization of the results. Furthermore, the mixing of different ages and genders is not suitable for this kind of sample.

Also, the control group is not established where healthy specimens are kept in a similar environment to factor out the effects of the environment and other components on the health/death of the animals.

Which are vital signs?
O temperature, respiratory rate, and weight
O muscle mass, height, and weight
Oheart rate, temperature, and height
temperature, respiratory rate, and heart rate

Answers

The correct combination of vital signs is temperature, respiratory rate, and heart rate.

Vital signs are key measurements that provide important indicators of a person's physiological status and overall health. They help healthcare professionals assess and monitor a patient's condition. The vital signs typically include temperature, respiratory rate, heart rate, and blood pressure. Among the options provided, the correct combination of vital signs is temperature, respiratory rate, and heart rate.

Temperature is a measure of the body's internal heat. It can be measured orally, rectally, or with the help of infrared thermometers. Deviations from the normal range may indicate fever or hypothermia, which can be indicative of underlying health issues.

The respiratory rate refers to the number of breaths a person takes per minute. It provides insight into lung function and overall respiratory health. Abnormal respiratory rates may suggest respiratory distress or underlying pulmonary conditions.

Heart rate, also known as pulse rate, measures the number of times the heart beats per minute. It reflects cardiac activity and can be assessed by feeling the pulse at various points in the body. Deviations from the normal heart rate can indicate cardiovascular problems or other physiological abnormalities.

Weight, muscle mass, and height are not typically considered vital signs. They are important anthropometric measurements used for assessing overall body composition, growth, and nutritional status. While these measurements are relevant in healthcare, they are not classified as vital signs.

In summary, the vital signs include temperature, respiratory rate, and heart rate. Monitoring these parameters allows healthcare professionals to gain valuable insights into a patient's health status, identify potential issues, and make informed decisions regarding treatment and care.

Know more about the vital signs here:
https://brainly.com/question/32396897

#SPJ8

Please help will mark most

Please help will mark most

Answers

Answer:

DNA ligase/ polymer

Explanation:

They are mismatched

A woman has two recessive alleles. What is her phenotype? (1 point)

Answers

Answer:

XX

Explanation:

A women's phenotype will always stay the same as XX.

Q. 31
During a DNA transcription, an error occurs, which inserts an Adenine. The non-
mutated sequence was:
AUGGGCCGGUACUUCCUUCUAGAUUACUUUCCCUACCGCGCUAGAUAA
If the protein is composed (after the mutation) of 7 amino acids, where would the
Adenine have been put?
X
24th base
21st base
30th base
27th base
26th base

Answers

The adenine would have been inserted after the 24th base in the mRNA sequence, corresponding to the sixth amino acid in the protein sequence, which is Leu.

What is DNA transcription?

DNA transcription is the process by which genetic information encoded in DNA is converted into RNA molecules. During transcription, the DNA double helix is unwound and one of the strands is used as a template for RNA synthesis. RNA polymerase, an enzyme, moves along the template strand, adding complementary RNA nucleotides to the growing RNA strand. The process continues until the RNA molecule is completed.

The process of transcription is tightly regulated to ensure that genes are expressed at the right time and in the right cells. Transcription factors, regulatory proteins that bind to specific DNA sequences, control the rate and specificity of transcription.

Mutations that disrupt transcription can lead to a variety of diseases, including cancer and genetic disorders.

Learn more about mutations here https://brainly.com/question/17031191

#SPJ1

How is the nitrogen cycle important to humans?

A.It produces free nitrogen that humans can breathe.

B.It converts nitrogen into a form that humans can obtain by eating other organisms.

C. It produces nitrogen compounds that humans can breathe.

D. It converts nitrogen into a form that humans can obtain by absorbing it through their skin.

Answers

The nitrogen cycle is important to humans in the following way: it converts nitrogen into a form that humans can obtain by eating other organisms (option B).

What is the nitrogen cycle?

Nitrogen cycle is the natural circulation of nitrogen in a series of processes by which nitrogen and its compounds are interconverted in the environment and in living organisms, including nitrogen fixation and decomposition.

During the nitrogen cycle, atmospheric nitrogen is converted to nitrogen oxides by lightning and deposited in the soil by rain, where it is assimilated by plants and either eaten by animals (and returned as faeces) or decomposed back to elemental nitrogen by bacteria.

The usable form of nitrogen that is assimilated by plants becomes accessible to humans when they consume the plants, hence, depicting the importance of the nitrogen cycle.

Learn more about nitrogen cycle at: https://brainly.com/question/1615727

#SPJ1

B В
4. Which of the following characterizes an ionic bond? (1 point)
The electrons in the bond are shared between two atoms.
The electrons in the bond are shared between two ions.
The bond results from the attractive forces of two similar charges.
The bond results from the attractive forces of two opposite charges.
O
s
Send
Print
Fax
Record
Lock
Details
Scan
Templates
Clain

Answers

Answer:

The bond from the attractive forces of two opposite charges

Explanation:

Ionic bond-A bond that is formed when electrons are lost or gained by the atoms in the compound...the opposite charges attract to one another forming the ionic bond.

When is lactic acid produced

Answers

During intense exercise, there may not be enough oxygen available to complete the process, so a substance called lactate is made. Your body can convert this lactate to energy without using oxygen. But this lactate or lactic acid can build up in your bloodstream faster than you can burn it.

hope this helps :)

(if you wouldn’t mind can you mark me brainliest?)

source of unsaturated fats______ source of molecules for short-term energy______source of amino acids ______

Answers

Source of unsaturated fats plants

Source of molecules for short-term energy ATP

Source of amino acids animal proteins.

Unsaturated fats are mostly found in plant-based foods including vegetable oils, nuts, & seeds. The most prevalent short-term energy molecule is ATP. There are four long-term energy storage molecules that are significantly bigger than ATP. Lipids, proteins, carbohydrates, & nucleic acids are examples. Animal proteins, such as beef, poultry, and eggs, are the finest suppliers of amino acids.

Animal proteins are really the easiest for your body to absorb and utilize. Complete proteins are meals that contain all nine essential amino acids. Unsaturated fats, that are liquid at room temperature, is considered healthy fats because they help lower cholesterol, reduce inflammation, normalize cardiac rhythms, and perform a range of other functions.

To know more about the Unsaturated fat, here

https://brainly.com/question/29193705

#SPJ4

The patient has been diagnosed with no Golgi apparatus in the cells. Does this present a problem with the diffusion of glucose across the plasma membrane?

1) No, this does not present a problem because the Golgi apparatus has nothing to do with the maintenance of the phospholipid bilayer and the diffusion of glucose into the cell.

2) Yes, this presents a problem because the Golgi apparatus packages up the transport proteins to be taken to the membrane and embedded in the phospholipid membrane to assist glucose diffusing into cell by active transport. Glucose would not be able to diffuse into the cell.

3) Yes, this presents a problem because the Golgi apparatus packages up the transport proteins to be taken to the membrane and embedded in the phospholipid membrane to assist glucose diffusing along its concentration gradient into the cell. Glucose would not be able to diffuse into the cell.

Answers

No, this does not present a problem because the Golgi apparatus has nothing to do with the maintenance of the phospholipid bilayer and the diffusion of glucose into the cell. That is option 1.

What is Golgi apparatus?

The Golgi apparatus is an example of the membrane bound organelles that are located within the cell which assists in the transport of materials such as synthesized proteins from within the cell to the exterior.

The molecules that are responsible for the transport of glucose is the glucose transporters (GLUTs) located within the cells, which transport glucose across the plasma membrane by means of a facilitated diffusion mechanism.

It can be concluded that when a patient is diagnosed with absence of Golgi apparatus, to transport of glucose should not be affected because there is not connection between Golgi apparatus and glucose transport within the cells.

Learn more about glucose here:

https://brainly.com/question/27998214

#SPJ1

Why is photosynthesis important process to green plants

Answers

Answer:

it's so that it can provide energy for the animals that needs to eat the food to live and also to provide oxygen.

Explanation:

photosynthesis is a process in which chlorophyll containing green plants in the presence of Sunlight uses carbon dioxide and water to synthesise their food photosynthesis is necessary for the plants to make food..

What are 2 similarities chromosomes you get from parents

Answers

The two similarities between chromosomes that you get from your parents are Genetic Material and Number of Chromosomes.

What more should you know about genetic materials and number of chromosomes you get from parents?

In terms of Number of chromosomes: Every Humans have 23 pairs of chromosomes, for a total of 46 chromosomes. Each parent contributes 23 chromosomes to their child, for a total of 46.

in tems of Genetic material: The chromosomes that you get from your parents contain the same genetic material. This is why you look like your parents and why you have inherited some of their traits.

Find more exercises on chromosomes;

https://brainly.com/question/1596925

#SPJ1

what is considered to be the source for new alleles

Answers

Answer:

Mutation

Explanation: Mutation is the ultimate source of new alleles in plant pathogen populations.

Other Questions
Which god interferes on the trojan side and directly contributes to the death of patroclus in iliad 16?. Im trying guys. Please help me. A 200 -kg object and a 500 -kg object. are separated by 4.00m. (b) At what position (other than an infinitely remote one) can the 50.0 - kg object be placed so as to experience a net force of zero from the other two objects? a nickel has 5 grams what is the mass of a nickel in milligrams Any wavelength longer than that of an electron would be too large for imaging. It follows that a shorter wavelength would have a ______ energy. How many degrees has PRQ been rotated to make PRQ HURRY PLEASEOne of the advantages of using a maglev system is that it (increases, decreases or does not affect) friction by utilizing non-contact forces to move and stabilize it. Solve; (a-b) power2 = (a+b)power2-4ab. 7. Estimate the product by rounding each number to the nearest ten.72 596 in 1990, which of the following declared that children should be considered to be competent witnesses unless there is evidence to the contrary?question 14 options:the child savers movementthe wheeler v. united states decisionthe victims of child abuse actthe national center on child abuse and neglect Which statement BEST contrasts the portrayal of war in Picture 1 and Picture 2? Which of the following is one of the 10 strategic operations management decisions? A) depreciation policy for tax returns B) advertising C) process and capacity design D) pricing E) debu/equity ratio Mr.fowler's science class grew two different varieties of plants as a part of a experiment . when the plant samples were fully grown,they compared their height A standard format for reporting a security incident prevents which of the following?A. Missing dataB. Copy and paste errorsC. The same type of incident in the futureD. Incomplete risk assessments what cells in our body work in concert to accomplish the task of antibody production according to ________, our society and healthcare institutions discriminate against certain diseases, which may affect the patient and the kind of care he or she receives. Math M111 Test 1 Name (print). Score /30 To receive credit, show your calculations. 1. (6 pts.) The scores of students on a standardized test are normally distributed with a mean of 300 and a standard deviation of 40 . (a) What proportion of scores lie between 220 and 380 points? (b) What percentage of scores are below 260? (c) The top 25% scores are above what value? Explicitly compute the value. 1, The activation energy of the reaction is 71 KJ/Mol how many time is greater the rate constant for the reaction at temperature of 170c and 150c. If an asset is intended to be sold in the ordinary course of business and but it may not be immediately ready for sale, then it is considered to be ________. The passage states that Lafayette joined the Masonic Military Lodge, where he could speak freely about the ideas of revolution and setting up a Republic. Based on this evidence, what conclusion can be made? A. Lafayette did not have any strong ideas about the revolution.B. Everyone in France had the same views on revolution as Lafayette did.C. The idea of revolution wasnt of interest to anyone who was in France.D. Lafayette could not speak freely about these ideas everywhere.