Answer:
The nucleotide sequence of a gene is transcribed into a nucleotide sequence of mRNA, which is read during translation in groups of three nucleotides that specify each amino acid.
Explanation:
Animal Cell Diagram
Pls help label them fast
Will mark brainlyest 75 points!
Joe Nuts believes that the moon is made out of cheese and is really happy about it. If he goes to the moon one day and finds out the truth how will he feel ?
Answer:
He would feel sad
Explanation:
This is because Joe couldn't dip his nuts in the cheese
D. Consider the following: The crabs that live in the aquatic biome pictured depend onliving in shallow water that has a temperature no greater than 60 degrees F. Ifclimate change causes an increase of that water's temperature to 62 degrees F, whatwill likely happen to the dolphins in that biome, and why?
Climate change is expected to be the main cause of mass extinctions in the 21st century and dolphins are not exempted. The swift warming of the planet leads to a loss of habitat for dolphins and increase competition for a lessening amount of prey species. It disturb the timing and ranges of their migration, distribution and ability to reproduce.
Some dolphins may not be able to survive and limit the ability to move northwards into cooler habitat as waters become warmer.
Why were Cynognathus fossils were important to Wegener's theory?
A They were found on lands now separated by a wide ocean
B They were the oldest fossil found at the time.
C They were found on lands joined together today.
D They were discovered in Antarctica and Africa.
What did Alfred Wegener try to prove with fossil evidence?
A that Earth is almost 5 billion years old
B that Earth is round, not flat
C that Earth once had no continents
D that Earth's landmasses move over time
Cynognathus fossils were important to Wegener's theory They were found on lands now separated by a wide ocean .
Cynognathus fossils are an important evidence for Wegener's theory as these were present over lands that are now separated by a wide ocean They also have iron particles that were present with in the Earth's magnetic field.
The important evidence that strongly supported the Theory of Continental Drift is the fossil record. Fossils record carries the evidence of similar types of plants and animals present on rocks of a similar age on the shores of different continents, suggesting that the continents were joined together.
To learn more about fossil , here
brainly.com/question/6867325
#SPJ1
Why did 40% of the human population evolve to tolerate lactose?(1 point)
1: Within cultures that rely on milk-producing animals, individuals who tolerated lactose had a survival advantage.
2: People who have an intolerance experience physical pain, so a tolerance evolved to avoid that.
3: Babies rely on milk to survive, so they need to be able to tolerate lactose.
4: Lactose tolerance allows people to enjoy a wide variety of food, including milk, butter, ice cream, and cheese.
Answer: The correct answer is 1: Within cultures that rely on milk-producing animals, individuals who tolerated lactose had a survival advantage.
Reason why its correct is: The answer is correct because within cultures that rely on milk-producing animals, individuals who tolerated lactose had a survival advantage. This means that people who could digest lactose were able to consume milk and milk products, which provided them with a valuable source of nutrition. This gave them an advantage over those who could not tolerate lactose and may have helped them survive and reproduce more successfully.
Answer:
1: Within cultures that rely on milk-producing animals, individuals who tolerated lactose had a survival advantage.
Explanation:
40% of the human population evolved to tolerate lactose because 1: within cultures that rely on milk-producing animals, individuals who tolerated lactose had a survival advantage.
The ability to digest lactose into adulthood (lactase persistence) became advantageous to humans after the invention of animal husbandry and the domestication of animal species that could provide a consistent source of milk. This is because milk is a good source of calories, protein, and other nutrients. Individuals who were able to digest lactose were able to get more of these nutrients from milk, which gave them a survival advantage.
Explain how DNA fragments are separated by gel electrophoresis
Gel electrophoresis is a widely used technique in molecular biology that allows for the separation of DNA fragments based on their size and charge.
The process involves several steps:
Preparation of the gel: A gel matrix, usually made of agarose or polyacrylamide, is prepared and poured into a gel tray. Small wells are created at one end of the gel, which will hold the DNA samples.
Loading the samples: DNA samples, which have been treated with restriction enzymes to generate fragments of different sizes, are loaded into the wells of the gel.
Applying an electric field: The gel tray is immersed in a buffer solution, and an electric field is applied across the gel. One end of the gel serves as the positive electrode (anode), and the other end as the negative electrode (cathode).
Migration of DNA fragments: When the electric field is applied, negatively charged DNA fragments migrate through the gel towards the positive electrode. Smaller fragments move more quickly through the gel matrix, while larger fragments move more slowly.
Visualization of DNA bands: After the electrophoresis is complete, the DNA fragments are visualized using stains or fluorescent dyes. The bands formed on the gel represent the separated DNA fragments, with each band corresponding to a specific size.
By analyzing the position and intensity of the DNA bands, researchers can determine the size of DNA fragments and gain insights into various genetic phenomena, such as gene mapping, DNA sequencing, and genetic variation analysis.
Know more about Gel electrophoresis here:
https://brainly.com/question/6885687
#SPJ8
How do fungi obtain nutrients? by secreting antibiotics and then absorbing killed bacteria by secreting chemicals that break down food and then absorbing it through photosynthesis by engulfing bacteria directly
Fungi obtain nutrients by secreting chemicals called enzymes that break down food and then absorb the nutrients through their hyphae.
This process does not involve photosynthesis, as fungi are not capable of producing their own food using sunlight like plants. While some fungi can produce antibiotics to kill bacteria, this is not their primary method of obtaining nutrients. Instead, they rely on breaking down various organic materials, such as dead plants, animals, or even living organisms, to absorb the nutrients they need for growth and reproduction.
To summarize, fungi obtain nutrients by:
1. Secreting enzymes that break down food.
2. Absorbing the released nutrients through their hyphae.
This process does not involve antibiotics, engulfing bacteria directly, or photosynthesis.
Learn more about Fungi at https://brainly.com/question/10878050
#SPJ11
A frog that is dominant for its light green color mates with a brown frog and produces one small brown frog. How is this possible if the green color is dominate?
Answer:
The dominant (light green) parent was heterozygote for the trait
Explanation:
According to Gregor Mendel in his law of dominance, an allele is said to be DOMINANT if it masks the phenotypic expression of another allele in a gene. The allele being masked is called RECESSIVE allele. In this case of a frog whose allele for light green color is dominant over the allele for brown color, the light green color allele (G) is dominant while the brown color allele (g) is recessive.
However, in a cross between that have light green frog and a brown frog, a small brown frog is produced. This is possible despite the green color being dominant because the genotype of the light green dominant parent is HETEROZYGOUS i.e. it contains both light green (dominant) allele and brown (recessive) allele.
Hence, when a gamete with recessive allele (g) is produced by the heterozygous light green frog (Gg), it mates with a recessive allele from the brown frog (gg) to produce a brown offspring (gg).
Which of the following is a
conversion from chemical to heat
and light energy?
A. Battery operated toy car spinning
B. Solar panel powering a house
C. Burning a candle
What type of electric current continually reverses direction?
Answer:
a.c current
Explanation:
alternating current continously changes its direction when flowing in a circuit . a.c current is used in transformer and a.c generator
i need a question about the reproduction of snails:
Based on what you were told about the reproduction of the snails, write a question that could be researched.
(hint: i don't remember what i was told... :P )
The question based on the research on Snail's reproduction is "If they are not hermaphrodites, can they still be male and female at the same time?".
How does reproduction occur in snail?Snails reproduce through the same way as other sexually reproducing organisms does through mate and lay eggs. Some snails are hermaphrodites, though they have both male and female sexual organs in the same individual. This indicated that the two snails can fertilize each-other.
Different snails reproduce differently, but most of the snails are hermaphrodites. Being a hermaphrodite means that a given snail can be both male and female at the same time, they have both the reproductive organs. This makes reproduction easier for snails and quickly make a whole lot of snails.
Some hermaphrodite snails do not need another snail to reproduce, but can make more snails by themselves. Other snails are hermaphrodites however they still need another snail to reproduce. There are also some snails that are not hermaphrodite, but are either male or female, and must find a snail of the opposite sex to breed with.
Learn more about Snails here:
https://brainly.com/question/4187812
#SPJ1
If the diploid number of a giraffe is 58, then the haploid number is __________________.
23
46
29
116
Answer:
C. 29
Explanation:
the haploid number is always half of the diploid number so half of 58 is 29
Cell phone vs Intoxicated driving 1. Is this an experiment? 2. What is the independent variable? 3. What is the dependent variable? 4. What are the operational definitions? 5. What is the experimental group/condition? 6. What is the control group/condition? 7. What confounds are present? 8. Who is the population? 9. Who is the sample? 10. Was there random assignment? 11. Was there selection bias?
This study compares the effects of cell phone usage and intoxicated driving on driving performance. It examines the independent variables of using a cell phone and driving under the influence, with the dependent variable being driving skills. The study includes experimental and control groups, while potential confounds include factors such as age, type of phone, alcohol/drug consumption, and duration of phone usage while driving. Random assignment is utilized, and to prevent selection bias, diverse participants could be included through stratified random sampling.
Cell phone vs Intoxicated driving is an example of a comparative study. Below are the answers to the given questions:
1. No, it is not an experiment.
2. The independent variable is the usage of a cell phone and intoxicated driving.
3. The dependent variable is the driving performance or skills.
4. The operational definition of cell phone usage is the participant talking on their phone while driving. The operational definition of intoxicated driving is the participant driving under the influence of alcohol or any other drugs.
5. The experimental group/condition is the participants who are driving while talking on their cell phones or driving under the influence of alcohol/drugs.
6. The control group/condition is the participants who are driving without any distraction or influence.
7. The confounds present in this study are the age of the participant, type of phone, quantity of alcohol/drugs consumed, and duration of using a phone while driving.
8.The population is the group of drivers who have a cell phone and can drive under the influence of alcohol/drugs.
9. The sample is the group of drivers who have volunteered to participate in the study.
10. Yes, the participants were randomly assigned to either the experimental or control group.
11. There could be selection bias if only certain types of participants were chosen. To prevent selection bias, the researchers could use stratified random sampling or randomly select from a diverse pool of participants.
Learn more about dependent variable at:
https://brainly.com/question/32711473
#SPJ11
Using the following nucleotide sequence, predict the complementary strand sequence:
5'-TTAAACCCGTTGGAAC-3'
5'-AATTTGGGCAACCTTG-3'
3'-AATTTGGGCAACCTTG-5'
03-CCGGGTTTACCAAGGT-5'
0 3'-TTAAACCCGTTGGAAC-5'
The predicted the complementary strand sequence for 5'-TTAAACCCGTTGGAAC-3' is 3'-AATTTGGGCAACCTTG-5'.
What is DNA?Deoxyribonucleic acid or DNA is a double helix molecule composed of two complementary strands.
According to the base pair rules, Adenine pairs with Thymine and Guanine pairs with Cytosine.
In conclusion, the predicted the complementary strand sequence for 5'-TTAAACCCGTTGGAAC-3' is 3'-AATTTGGGCAACCTTG-5'.
Learn more about base complementarity here:
https://brainly.com/question/19670398
#SPJ1
Answer:
Your answer would be AATTTGGGCAACCTTG-5′
Explanation:
Cellular respiration is the name for the process of breaking down organic molecules in the presence of oxygen. Which of these processes is the opposite
chemical reaction?
O mitosis
O osmosis
O fermentation
O photosynthesis
Cellular respiration is the name for the process of breaking down organic molecules in the presence of oxygen.Photosynthesis is opposite to it. The correct answer is option D.
What is the source of solar energy ?The source of solar energy is sun from which the plants get their food produced.
Mitosis is the kind of division in which the same types of cells are formed and in this division there is formation of identical cells and the property by which the differentiation is given to the cells are also produced by the same.
Osmosis is the kind of process in which there is movement of particles from lower concentration to the higher concentration. The process takes place in plants most commonly in order for the food transportation.
Fermentation is the process taking place in the absence of oxygen and basically it implies with the process of making alcohol ad the process is am anaerobic respiration.
Learn more about photosynthesis at :
https://brainly.com/question/1757345
#SPJ2
1) Choose the correct answer.
Science is the study of events and conditions of the world.
O natural and supernatural
O natural
O all
O supernatural
Science is the study of events and conditions of the natural world.
What is science?Science is a systematic and logical approach to discovering how the natural world works. It is a process of acquiring knowledge through observation and experimentation and testing hypotheses and theories to explain natural phenomena.
Science aims to develop a deep and comprehensive understanding of the universe, from the smallest particles to the largest structures, and everything in between.
It involves the use of the scientific method, which includes the following steps:
ObservationAsking questionsMaking a hypothesisExperiments, etcLearn more about science at: https://brainly.com/question/28416408
#SPJ1
point mutations are referred to as missense, silent, frameshift, or nonsense when they change the protein-coding potential of a gene. what is another group of mutations that may have important consequences for gene expression?
Mutations that exist outside coding sequences as point mutations are referred to as missense, silent, frameshift, or nonsense when they change the protein-coding potential of a gene.
What is mutation?A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of errors in DNA replication during cell division, mutagen exposure, or viral infection. A mutation is a permanent change in the nucleotide sequence of an organism's genome, virus, extrachromosomal DNA, or other genetic components. Small-scale mutations and Large-scale mutations are two types of gene structural mutations. A genetic mutation is a change in the DNA sequence of a gene that results in something different. It causes a permanent alteration in the DNA sequence of that gene. Human evolution, or the process of change across generations, requires genetic variances. A random genetic mutation arises in a single individual.
To know more about mutation,
https://brainly.com/question/17106056
#SPJ4
Explain the process that links the physical sensory world and
the brain for each of the senses (vision, hearing, taste, smell,
and touch).
The process that links the physical sensory world and the brain for each of the senses (vision, hearing, taste, smell, and touch) is known as transduction.
Here's how transduction works for each of the senses:
1. Vision: The eye transduces light energy into neural impulses, which are then transmitted to the brain via the optic nerve.
2. Hearing: The ear transduces sound waves into neural impulses, which are then transmitted to the brain via the auditory nerve.
3. Taste: Taste buds on the tongue transduce chemical signals from food into neural impulses, which are then transmitted to the brain via the gustatory nerve.
4. Smell: Olfactory receptor cells in the nose transduce chemical signals from odors into neural impulses, which are then transmitted to the brain via the olfactory nerve.
5. Touch: Sensory receptors in the skin transduce physical pressure, temperature, and pain into neural impulses, which are then transmitted to the brain via various sensory nerves.
Learn more about transduction: https://brainly.com/question/30747855
#SPJ11
i will give you brainliest What is the most important organ in the human body?
Answer: Its the brain because it controls everything in your body
Explanation:
Have great day
You have isolated a bacterium from a patient's infected wound. The bacterium is oxidative and does not hydrolyze starch. Identify the bacterium.
The fact that the bacterium is oxidative indicates that it is capable of utilizing oxygen for its metabolic processes. This characteristic is often associated with aerobic bacteria.
On the other hand, the bacterium not hydrolyzing starch suggests that it lacks the enzyme amylase, which is required to break down starch into simpler sugars. This characteristic narrows down the possibilities, as many bacteria possess amylase activity.
To accurately identify the bacterium, further tests and observations, such as Gram staining, biochemical tests (e.g., fermentation, motility), and potentially molecular techniques (e.g., DNA sequencing), would be necessary to determine its genus and species.
Learn more about bacteria, here:
https://brainly.com/question/15490180
#SPJ1
Why do some species self clone when in captivity?
Self-cloning, or parthenogenesis, is a reproductive strategy in which an individual can produce offspring without the need for fertilization by a male.
Why do some species self clone when in captivity?In captivity, some species may experience changes in their environment that can trigger self-cloning as a response to stress or lack of mating opportunities.
This is more likely to occur in species that have the ability to switch between sexual and asexual reproduction depending on environmental conditions.
Self-cloning can also be a result of genetic mutations or abnormalities that prevent normal sexual reproduction from occurring. In some cases, individuals that are unable to mate successfully may resort to self-cloning as a means of ensuring their genetic lineage continues.
Additionally, some species are naturally capable of parthenogenesis, and this ability may become more prevalent in captive populations due to a lack of genetic diversity and mating opportunities.
Learn more about self clone here: https://brainly.com/question/18507538
#SPJ1
usually, a river ________ at its source compared to farther downstream.
There can be many answers for these king of question for eg:- Its wider
1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose?
When cloning by restriction digest and ligation, restriction enzymes are used to cut open a plasmid (backbone) and insert a linear piece of DNA (insert) cut by suitable restriction enzymes.
How do restriction enzymes of type 2 cleave DNA?Type II restriction enzymes are the ones that are most commonly utilised in molecular biology applications including gene cloning and DNA fragmentation and analysis. These enzymes break DNA at certain places in relation to their recognition sequence, resulting in repeatable fragments and discrete gel electrophoresis patterns.
Traditional classifications of restriction enzymes are based on subunit composition, cleavage location, sequence specificity, and cofactor requirements.
learn more about electrophoresis patterns
https://brainly.com/question/13813089
#SPJ1
Read each description below regarding innervation of the ANS. Then click and drag each into the appropriate category base on whether it is an example of antagonic or cooperative innervation
The question is incomplete. Here is the complete question.
Read each description below regarding the dual innervation of the ANS. Then click and drag each into the appropriate category base on whether it is an example of antagonic or cooperative innervation.
The sympathetic division stimulates mucus production by salivary glands while the parasympathetic division stimulates enzyme secretion.
The sympathetic division stimulates am increase in heart rate while the parasympathetic division stimulates a decrease in heart rate.
During sex, the parasympathetic division stimulates arousal while the sympathetic division stimulates orgasm.
The parasympathetic division constricts the pupils while the sympathetic division dilates the pupils.
Antagonistic:
Cooperative:
Answer: Antagonistic: The sympathetic division stimulates am increase in heart rate while the parasympathetic division stimulates a decrease in heart rate; The parasympathetic division constricts the pupils while the sympathetic division dilates the pupils.
Cooperative: The sympathetic division stimulates mucus production by salivary glands while the parasympathetic division stimulates enzyme secretion.; During sex, the parasympathetic division stimulates arousal while the sympathetic division stimulates orgasm.
Explanation: The peripheral nervous system is divided in Somatic Nervous System (SNS) and Autonomic Nervous System (ANS). The first is responsible for sensory input and voluntary motion.
Autonomic Nervous System is divided into Sympathetic and Parasympathetic divisions and is controls the fight-or-flight and rest-and-digest situations. Usually, an organ with sympathetic and parasympathetic innervations have antagonic function, such as the heart rate - one system causes the heart rate to increase while the other stimulates the rate to decrease. However there are cases in which the combination of the 2 systems cause an increase of stimulation, producing similar effects.
Analysing each category above, it is deductable that when the sympathetic stimulates mucus production and parasympathetic, enzyme secretion and when the parasympathetic stimulates arousal and sympathetic, orgasm, in both cases, they have cooperative innervation.
On the other hand, when sympathetic stimulates increase in heart rate and parasympathetic, decrease in the rate, as stated before, and one stimulates constriction of the pupils and the other, dilation of the them, those are examples of having antagonic innervation.
which celestial object is the smallest
Photosynthesis and Cell Respiration Questions.
Answer:
1.) a
2.) b
3.) c
4.) a
5.) b
6.) Are there any other options? none of those options are right because energy is released from ATP when a phosphate group is removed.
What is the function of the cell wall?
A. to contain the genetic information of an organism
B. to package proteins in an animal cell
C. to transport materials throughout a cell
D. to provide structural support for a plant cell
Answer:
D
Explanation:
the answer is d the cell wall provides support and protection
this is a form of communication that has rules for the use of sounds and symbols.
Language is a form of communication that has rules for the use of sounds and symbols.
Language is a set of rules and symbols used to create meaningful communication. To be regarded as a language, a means of communication must fulfil the following requirements: To express things, activities, events, and ideas, a language requires symbols, which can be sounds, gestures, or written letters.
Gestures, which are a common means of communication for most people, are the foundation of signs. A visual mode of communication, signing should supplement speech rather than take the place of it. The words used in the message are given additional visual information via signs, making the message easier to interpret.
Learn more about communication:
https://brainly.com/question/31810546
#SPJ4
The complete question is:
_____ is a form of communication that has rules for the use of sounds and symbols.
A major role of protein in the body is to ________. A slight overload on the muscle triggers cellular breakdown and then protein synthesis of each muscle cell in order to adapta. remodel and build cellsb. provide energy during exercisec. maximize muscle glycogen stores
A major role of protein in the body is to option a. remodel and build cells.
What is protein? Protein is one of the most important nutrients required for muscle growth and repair. It's a macronutrient made up of amino acids and it's responsible for a variety of bodily functions, including building and repairing cells and tissues, producing enzymes and hormones, and supporting the immune system. Protein is critical for remodeling and building cells, and it is often consumed in greater amounts by athletes and bodybuilders. Amino acids from protein help to repair and regenerate muscle fibers after exercise-induced damage, resulting in muscle growth over time. A slight overload on the muscle triggers cellular breakdown and then protein synthesis of each muscle cell in order to adapt and build cells. When we exercise, we put stress on our muscles. This stress causes tiny tears in the muscle fibers, which then need to be repaired. In response to this damage, our bodies activate satellite cells and begin a process called protein synthesis. During protein synthesis, amino acids from protein are used to rebuild and strengthen the damaged muscle fibers, resulting in muscle growth and repair.
Learn more about functions of protein: https://brainly.com/question/10058019
#SPJ11
Use equation 1 from the section to calculate the PCV in each centrifuge tube from the blood sample your group was assigned to test . Record each PCV in the data table below
The packed cell volume is checked in cases where there are symptoms of anemia or erythrocytosis.
The PCV which is also known as packed cell volume is equal to the volume of packed red blood cells which is divided by the total volume of the given blood sample.
GIVEN - Red blood cell volumes are -
5.5 , 5.0 , 5.0 , 5.0 , 4.0
Total blood mixture volume is -
10.0, 10.5 , 10.0 , 10.5 , 9.5
SOLUTION - To calculate the packed cell volume -
5.5 / 10.0 = 0.55
5.0 / 10.5 = 0.47
5.0 / 10.0 = 0.5
5.0 / 10.5 = 0.47
4.0 / 9.5 = 0.42
The main function of packed cell volume is to calculate the red blood cell mass because any increase in the red blood cell mass will be equal to erythrocytosis which means the count of red blood cells is more than the specific sex normal range which is because of plasma volume reduction and also if it decreases then it will lead to anemia because it will have lesser number of red blood cell count and for determining anemia or erythrocytosis the blood test is advised and the reason behind this is cell destruction, blood loss, or failure of bone marrow production and the other name for packed cell volume is hematocrit or volume of packed red cells or erythrocyte volume fraction.
To know more about packed cell volume click at https://brainly.com/question/13326815
#SPJ9