Answer:
orbit
Explanation:
Whats the difference between comets,asteroid’s, and meteors
Answer:
Comets are small icy dirtballs that orbit the Sun; comets are made of ice and dust while asteroids are made of rock). A meteor is a space rock—or meteoroid—that enters Earth's atmosphere, as it – burns up upon entering Earth's atmosphere, it creating a streak of light in the sky (often called "shooting stars").
Explanation:
Answer:
A comet is a ball of ice and dust that orbits the sun
A asteroid is a small rocky object
A meteor is a small piece of a asteroid or comet......
Explanation:
To remember think of it this way Comets are big , Asteroids are small
Meteors are pieces of them both
According to the law of superposition, fossils found at which position in these
layers of rock are likely to be the youngest?
Ο Α. Α
OB. B
О с. с
OD. D
ED
C
A
We
B
The law of superposition states that fossils found in the uppermost layers, i.e., layer A, are more recent than those found in the other layers, so option A is correct for the youngest fossil.
What is the fossil's importance?When the environment changes due to climatic changes, animals or plants remain under the rocks, leaving their imprints or hard parts of their bodies, which are later studied to learn about ancestors. The fossils that are present in the lowermost rock layers are the oldest, while the uppermost layer is the youngest as it is newly formed.
As a result, the law of superposition states that fossils found in the uppermost layers, i.e., layer A, are more recent than those found in the other layers, so option A is correct for the youngest fossil.
Learn more about the fossil's importance here.
https://brainly.com/question/19507461
#SPJ1
Describe how removing the carnivore will effect the population of producers
Answer:
If there were no carnivores, the herbivore populations would explode and they will rapidly consume large amounts of plants and fungi, growing until there is not enough food to sustain them. Eventually, the herbivores would starve, leaving only those plants that were distasteful or poisonous to them.
Explanation:
Brainliest PLZ
During June, the northern hemisphere experiences summer and the southern hemisphere experiences winter. During
December, the northern hemisphere experiences winter and the southern hemisphere experiences summer.
Why do the two hemispheres experience opposite seasons at the same time?
A) Earth is closer to the Sun during June and farther from the Sun during December.
(B The equator receives more sunlight than the northern and southern hemispheres.
C) The tilt of the axis causes the two hemispheres to receive different amounts of sunlight at different times of the year.
D) The Earth orbits more slowly in June causing the sun to shine brighter during the summer months than during the winter
Answer: C
Explanation:
Because the tilt of the earth on its access causes one half of the earth to get more direct sunlight because its pointed right at the sun while the other half is getting non direct sunlight making it colder in that part.
The vultures belong to a group called "detritivores." What are detritivores?
Detritivorous are a group of animals that feed from dead organic material.
Conclusion:
Include the following as a summary paragraph in the conclusion of your lab report:
Analysis of the results of the experiment
I
Based on your data, describe the overall trend for each of the five
factors that were measured?
What information do your graphs show? Describe the correlation
between the two factors that you graphed
● Rationale for the support or rejection of the hypothesis
Questions:
Using what you have learned in the lesson and the virtual lab activity, answer the
following questions in complete sentences:
1. Identify the abiotic and biotic factors in this lab.
2. Describe the symbiotic relationship between each of the organisms.
3. Explain how the limiting factors affect carrying capacity in each population.
Answer:
Your conclusion will include a summary of the lab Describe the overall trend for each of the five factors that were measured
Explanation:
Which two events are part of the rock cycle?
O A. Carbon cycles between plants and animals.
B. Plants take minerals from soil and grow.
C. Melted rock cools and solidifies.
D. Sediment is buried and compacted.
C: melted rock cools and solidifies
D: sediment is buried and compacted
Answer:
1) Sediment is buried and compacted
2) Melted rock cools and solidifies
Explanation:
Trust me love
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
Convert 650 mm Hg to kPa and atm
In many suburban
neighborhoods, houses are spread
very regularly across the
landscape. The humans in the
neighborhood have a
dispersal pattern.
The humans in the neighborhood where houses are spread regularly have a uniform dispersal pattern.
Spatial distribution of populationsThe spatial distribution of populations refers to the pattern of distribution of individuals within the population.
Individuals within a population are dispersed based on factors such as the availability of food, access to roads, etc. This is otherwise known as an active movement.
In other instances, individuals within the population are moved passively by factors such as wind, water, presence of other individuals.
Individuals within a population can be distributed in one of 3 ways:
Random distribution: when individuals are distributed in such a way that no specific pattern is formed. Clumped distribution: when individuals within a population are concentrated to a specific point or clumped together.Uniform distribution: when individuals that make up a population are distributed regularly across the entire area covered by the population.In a random distribution, houses are also likely to be randomly sited across the population area. In clumped population distribution, houses are usually clumped together. In uniform population distribution, houses are usually regularly spread across the landscape covering the area of the population.
More on population distribution can be found here: https://brainly.com/question/14894462
#SPJ1
PLEASE HELP- Which step in developing a
balanced ration involves
determining what feedstuffs are
available in your location?
Answer:
1
Explanation:
step 1 because it shows locations
What is believed to be the main cause of most mass extinctions throughout geological history?
Answer:
was caused by global warming that left ocean animals unable to breathe. The largest extinction in Earth's history marked the end of the Permian period, some 252 million years ago
Explanation:
Explain the similarities and differences that exist between extinct species and humans.
Answer:
Difference Between Endangered Species and Threatened Species. ... what are the other causes apart from humans that can drive an entire species to ... When a species exist no longer, it is considered as extinct.
.Explain why the scientific process is important when learning about diseases.
Answer:
The scientific process is important when learning about diseases because it allows to obtain reliable and valid knowledge about the different existing diseases, it helps in solving problems correctly and it is the best tool to nullify arbitrary opinions regarding a diagnosis or treatment, taking into account each of its stages.
Explanation:
The scientific method is a process through which relationships between facts are established to arrive at the verification of something. Through this step by step in which facts are discarded and added, the answers to findings are based. It is through the information generated by the research that it is possible to associate and / or integrate a set of symptoms and signs with a probable nosological diagnosis. Similarly, the selection of treatment and even the prognosis of patients depend on the information obtained from a population of subjects who share attributes; they depend, in a word, on research. Bearing in mind the scientific process, scientific thinking develops with practice, and for this it is necessary that there be constant reflection on the problems, have guides for the interpretation of medical reading, develop research protocols, learn to collect and analyze data about diseases.
Scientific is very important in order to obtain information about the disease.
The scientific process is important when learning about diseases because it provides information about various aspects of diseases as well as provides solution about cure of the disease.
This scientific process or method can be used for obtaining information about the causes of disease, its causing agents and cure for the disease so we can conclude that scientific is very important in order to obtain information about the disease.
Learn more: https://brainly.com/question/18646268
Draw A Punnett Square For Qq and QQ . Explain What The Punnett Square Represents.
Answer:
QQ, QQ, Qq, Qq
Explanation:
Set it up and then solve.
What new knowledge was gained from Frederick Griffiths work with pneumococci bacteria
Answer:The new knowledge gained from Frederick Griffith's work with pneumococci bacteria is that bacteria contain a physical substance that can change the structure of other bacteria. Therefore, option 3 is the correct answer.
Explanation:
where do land plants get the water that they use in photosynesis
Answer:
Land plants get the water they use in photosynthesis from the soil through their roots.
Land plants obtain water for photosynthesis from the soil, which is absorbed through their roots and transported to the leaves through the xylem.
Land plants obtain water for photosynthesis primarily from the soil. The process involves a series of steps that enable water uptake and transportation within the plant. First, plant roots, equipped with root hairs, extend into the soil and absorb water through osmosis. This occurs because the concentration of dissolved substances, such as minerals, in the root cells is higher than that in the surrounding soil.
Water moves from the roots to the xylem, which is a specialized tissue responsible for transporting water and nutrients throughout the plant. This upward movement is facilitated by a combination of root pressure, capillary action, and most importantly, transpiration. Transpiration is the loss of water vapor from the plant's leaves through small openings called stomata. As water evaporates from the leaf surfaces, it creates a negative pressure gradient that pulls water up through the xylem from the roots.
Once water reaches the leaves, it is utilized during photosynthesis. The water molecules are split during the light-dependent reactions, releasing oxygen as a byproduct and providing electrons for the production of ATP and NADPH, which are essential for the light-independent reactions (Calvin cycle).
In summary, land plants rely on their roots to absorb water from the soil, which is subsequently transported through the xylem to the leaves where it is utilized in the process of photosynthesis.
Know more about xylem here:
https://brainly.com/question/14197052
#SPJ8
Once a cumulus cloud has formed, what needs to happen in order to produce a
thunderstorm?
A downdraft in the atmosphere needs to activate
the water droplets to begin falling.
Some of the accumulated water droplets need to
detach from th cumulus cloud.
Enough water droplets need to band together to
start falling back to earth as rain.
The temperature needs to increase rapidly before
anything will change.
Answer: Enough water droplets need to band together to
start falling back to earth as rain.
Explanation: I took the test
Giant sequoias can grow to be nearly 100 meters (328 feet) tall. They rely on a complex transport system to allow
water to travel from the roots to the leaves at the top of the tree.
Which transport tissue allows water to travel upward from the roots to the leaves?
Enter your answer in the box.
The transported tissue that allows water to travel upward from the roots to the leaves is the xylem tissue in vascular plants such as in this case giant sequoia.
What is the function of the xylem tissue in trees and vascular plants?The function of the xylem tissue in trees and vascular plants is to transport water and dissolved solutes from the roots to the upper organs, i.e., the shoot and leaves.
Therefore, with this data, we can see that function of the xylem tissue in trees and vascular plants is based on water transport.
Learn more about the plant xylem here:
https://brainly.com/question/21090546
#SPJ1
Can someone please help me idk the answer.
If you are able to answer thank you
look up plutos actual period in the gizmo. what is it and how does it compare to the calculated value
The prompt is culled from "HonerScience" Gizmo. The objective is the compare the Planetary motion of Pluto's Orbital Radius, against the period of it's Orbit as depicted in the Gizmo. It is to be noted that Pluto's Orbital Radius is 39.529 AU while it's period of Orbit is 249 years.
What is Orbital Radius?For roughly circular orbits, the orbital radius is the distance between an item in space and the body it is circling. When an object circles a body in space, it spins around it, forming a circle or an ellipse depending on the orbit.
If the mass of the orbiting star is known, Kepler's Third Law may be used to calculate the planet's orbital radius (R3=T2Mstar/Msun, the radius is in AU, and the period is in earth years).
The earth's radius and the radius of its orbit around the sun are 6371 km and 149x109 km, respectively.
Learn more about Pluto:
https://brainly.com/question/19910641
#SPJ1
Examination of the amino acid composition of a newly isolated protein indicates the presence of 10 lysines, 5 arginines, and 3 methionines. When the protein is treated with cyanogen bromide, four peptides are obtained. When it is treated with trypsin, 15 peptides are obtained. What do these results suggest regarding the sequence of the protein?
Answer:
It means that the cyanogen bromide hydrolyzes methionine residues with high efficiency, while trypsin is an enzyme that cuts proteins at lysine and arginine peptidic bonds, thereby producing 4 and 15 polypeptides, respectively.
Explanation:
Cyanogen bromide is a pseudohalogen compound that is used to cut the C-terminus of the methionine residues. On the other hand, the trypsin is an enzyme produced by the pancreas as trypsinogen that is used by the digestive system (intestine) to digest polypeptides.
Which two parts of sedimentary rock formation include the breakdown and carrying away of existing rock?
cementation and erosion
compaction and cementation
deposition and compaction
erosion and weathering
The two parts of sedimentary rock formation that include the breakdown and carrying away of existing rock are erosion and weathering. Thus, the correct option for this question is D.
What do you mean by Weathering?Weathering may be defined as a type of process through which a large rock is gradually broken down into smaller fragments by the action of water, wind, roots of plants, etc. Weathering is of two types:
Physical weathering/Mechanical weathering:Chemical weathering.When the process of weathering may be terminated, the activity of erosion may have occurred. This activity is also carried out by factors like water air, overgrazing of cattle, human activities like deforestation, etc. The main effect of soil erosion is to remove the topsoil which is extremely fertile in nature.
Therefore, erosion and weathering are the two parts of sedimentary rock formation that include the breakdown and carrying away of existing rock. Thus, the correct option for this question is D.
To learn more about Sedimentary rocks, refer to the link:
https://brainly.com/question/7437433
#SPJ6
The cell membrane is known as the fluid mosaic model.
True
False
Answer: the answer is true
Is there DNA in oreos?
Answer:yes
Explanation:
Which of the following is not an essential component of public health?
A.Stopping equitable access to resources
B.Building a diverse and skilled workforce
C.Strong infrastructure for public health
D.Effective communication and education
Answer:
Stopping equitable access to resources is not a essential component to public health.
Explanation:
The one that is not an essential component of public health is stopping equitable access to resources. The correct option is A.
What is public health?The science and art of preventing disease, extending life, and promoting health efforts and informed decisions of society, organizations, public and private, communities, and individuals has been defined as "the science and art of preventing disease, extending life, and promoting health."
Stopping equal access to resources is one that is not a necessary component of public health.
Thus, the correct option is A.
For more details regarding public health, visit:
https://brainly.com/question/14894636
#SPJ5
During cytokinesis, the cell membrane ________ until two daughter cells separate completely.
A
expands
B
dissolves
C
pinches in
D
spins around
Answer: C - Pinches in
Explanation:
During cytokinesis, the cell membrane expands until two daughter cells separate completely. The correct option is c.
What is cytokinesis?Cell division includes both mitosis and cytokinesis, and they are intimately tied to one another. In reality, mitosis is a process in which a cell's replicated genome is split into two parts, each of which is always identical. Through the process of cytokinesis, a cell divides into two "daughter" cells.
After telophase, the cell undergoes cytokinesis, during which the cytoplasm splits to create two daughter cells. The cell then goes through the G0 phase, the quiescent period of cell division during which no cell division takes place.
The cell gets expands and the cell organs divide, then after the membrane divides itself and converts into two cells.
Therefore, the correct option is C. expands.
To learn more about cytokinesis, refer to the link:
https://brainly.com/question/20223797
#SPJ6
Where does the energy come from to make ATP in the light reactions?
Answer:
Figure 19.2. The Light Reactions of Photosynthesis. Light is absorbed and the energy is used to drive electrons from water to generate NADPH and to drive protons across a membrane. These protons return through ATP synthase to make ATP.
Explanation:
thank me later
Which conclusion do the data in the graph support?
Conclusion on the graph supports that D, when forests are cut down faster than they can be replenished, biodiversity quickly decreases.
Why is biodiversity decreasing?The graphs show that the consumption of lumber has been increasing over time. This means that more trees are being cut down each year. However, the amount of forest resources has been decreasing over time. This is because trees are being cut down faster than they can grow back. As a result, there are fewer trees in the forest, and the forest is less able to support biodiversity.
The graphs also show that biodiversity has been decreasing over time. This is because the forest is less able to support a variety of plants and animals when there are fewer trees. As a result, the forest is less healthy and less able to provide the benefits that we depend on, such as clean air and water.
Find out more on forest biodiversity here: https://brainly.com/question/9850923
#SPJ1
Complete question:
Which conclusion do the data in the graphs support?
A. When forests are cut down faster, they are replenished faster, and biodiversity is maintained.
B. As consumption of lumber increases, forest resources and
biodiversity also increase.
C. As consumption of lumber decreases, forest resources and
biodiversity also decrease.
D. When forests are cut down faster than they can be replenished,
biodiversity quickly decreases.