Answer:
IT IS WRONG SOME GUY SAID A IT ACTULLY B
Explanation:
can someone please help me on this all u have to do is search up on the internet and then put down 4 facts that are mentioned in the web site and give the main idea to but make sure I know were the main idea is
web site: The de-extinction of the woolly mammoth would be an evolutionary mistake
1:As of recently, the essential contention for species de-termination was that it offered humankind an opportunity to make up for itself for the wrongs submitted north of millennia. People, one could really guarantee, have been messing up the planet since days of yore. Thus, a large number of the species that have been the objectives of de-termination endeavors have been picked on the grounds that they appear to have some essential thing right to make due. Frequently, they look similar as species that have made due until the present time. Assuming it hadn't been for people meddling with their normal natural surroundings and sensitive environments, the contention goes, they would have been prospering today.:2To get around this contention, however, a few researchers are beginning to put forth the defense that it wasn't Mother Nature who did in the wooly mammoth — it was people. When the planet began to defrost, people came into contact with the wooly mammoth in more prominent numbers, and started to chase them savagely after their meat, bones and even skin. It's basically the traveler pigeon proposal, stretched out to the wooly mammoth. De-eradication fans will most likely let you know that people bear a sort of transformative responsibility for having cleared out the wooly mammoth, quit worrying about environmental change.:3creating a highly-controlled environment (i.e. a theme park) where the wooly mammoth could conceivably flourish – it doesn’t reason that you can simply hit the “rewind” button on evolution. As some conservationists are already warning, bringing back a species like the wooly mammoth could lead to the disappearance of other species who share similar habitats. Once you bring back a new species, you have to start thinking about ecosystem effects — and about Butterfly Effects. Bringing back the wooly mammoth would require massive changes to existing ecosystems.:4Yet, that equivalent contention – an opportunity to reclaim human bad behaviors over an improper annihilation – doesn't hold on account of the wooly mammoth. The wooly mammoth, with its monstrous hair coat to save warmth, had no way for endurance once the Ice Age finished. As Darwin originally guessed, advancement resembles a calculation followed commonly. In the event that a variation assists an animal varieties with getting by and thrive, the transformation will stick. Assuming it doesn't, it will ultimately vanish from the genetic stock. For better or for more regrettable, certain species will go terminated when they can presently don't adjust to their current circumstance. It wasn't only that wooly mammoths had substantial hair coats – they had a wide range of different variations that assisted them with flourishing during the Ice Age, as enormous tusks to clean up snow and ice. Bringing back the wooly mammoth would be commensurate to bringing back an animal types that had the right to go terminated. : main idea Accepting totally effective cloning to make sound creatures, the cloned wooly mammoths would in all likelihood have hopeless existences and couldn't have ever evident freedomWhat's more not just the productive restoration of the wooly mammoth, but it's full rewilding into the Arctic." Bringing species like the wooly mammoth back into the frosty might perhaps help deferred down non-renewable energy source side-effects in the area and help with restoring lost organic frameworks, Lamm said.But think about how conceivable it is that they somehow made due. Our Arctic regions would look an incredible arrangement changed, and not because there would be huge assessed, shaggy animals meandering around. There would be less elk, moose, and caribou considering the way that the wooly mammoth would out battle them for food.Assuming absolutely viable cloning to make sound animals, the cloned wooly mammoths would probably have miserable presences and couldn't have ever clear freedomLamm said expecting the association is productive, research has shown bringing back ended species could reshape the Siberian tundra and in other Arctic regions to be more specialist of the normal game plan of the Arctic glades when it was an unrivaled carbon-sequestering areaLamm said assuming the organization is effective, research has shown bringing back wiped out species could reshape the Siberian tundra and in other Arctic districts to be more agent of the biological arrangement of the Arctic fields when it was a superior carbon-sequestering location.But imagine a scenario in which they some way or another made due. Our Arctic locales would look a ton changed, and not on the grounds that there would be enormous measured, shaggy creatures meandering around. There would be less elk, moose, and caribou in light of the fact that the wooly mammoth would out contend them for food.
Question 9
What does it mean if the G2 checkpoint fails during cell Division
Answer:
If the checkpoint mechanisms detect problems with the DNA, the cell cycle is halted, and the cell attempts to either complete DNA replication or repair the damaged DNA.
Explanation:
The G2 DNA damage checkpoint is an important cell cycle checkpoint in eukaryotic organisms that ensures that cells don't initiate mitosis until damaged or incompletely replicated DNA is sufficiently repaired. Cells that have a defective G2 checkpoint enter mitosis before repairing their DNA, leading to apoptosis or death after cell division.
When someone is admitted to the hospital, one of the first procedures health-care professionals perform is a blood draw. One lab value checked is a white blood cell (WBC) count. If the WBC count is elevated (normal range 4 4,000–11,000/mm3), this could indicate the presence of inflammation. Further analysis (called a differential) is performed to determine the relative prevalence of different types of white blood cells and the potential cause of the inflammation. What might be causing the inflammation if lymphocytes were elevated? Explain your reasoning.
If lymphocytes are elevated in the differential analysis of a blood sample, it could indicate the presence of a viral infection, such as mononucleosis or the flu.
What are lymphocytes and what are the causes of the elevation in their levels?Lymphocytes are a type of white blood cell that plays a critical role in the body's immune response to viral infections. When the body is infected with a virus, the lymphocytes become activated and increase in number to fight off the infection.
Other possible causes of elevated lymphocytes include bacterial infections, autoimmune diseases, and certain types of cancer, such as leukemia and lymphoma. However, in most cases, an elevated lymphocyte count is associated with viral infections.
It is important to note that an elevated lymphocyte count alone does not provide a definitive diagnosis of a particular disease or condition. Further testing, such as viral testing or imaging studies, may be necessary to confirm a diagnosis and guide treatment.
Learn more about lymphocytes here:
https://brainly.com/question/25397351
#SPJ1
Reproduction involves the transfer of genetic information from?
Answer:
Reproduction involves the transfer of genetic material from parent to offspring. There are 2 types of reproduction. Sexual and asexual reproduction. Sexual reproduction is the production of a new organism from 2 parents.
Explanation:
Answer:
from the sperm to the egg?
Explanation:
im pretty sure that is the answer
This event occurs directly following mitosis, and is called
metaphase
anaphase
prophase I
cytokinesis
Cytokinesis is the term used to describe the process that follows mitosis.
What occurs during the mitosis?A cell divides into two identical daughter cells after duplicating every component of it, including its chromosomes, during the mitotic process. The processes of mitosis are meticulously regulated by certain genes since this process is so crucial. Cancer can develop when mitosis is improperly controlled, among other health issues.
What is the purpose of mitosis?In the cell division process known as mitosis, the chromosomes multiply and are evenly distributed across the two daughter cells. Each daughter cell has a same number of chromosomes to the parent cell, making the cell type diploid. Mitosis is hence also known as equational division.
To know more about Mitosis visit:
https://brainly.com/question/26678449
#SPJ4
Humans pump water out of the aquifers in the ground to use in their homes. How would this effect the land on top of the aquifer?
A specific type or RNA that delivers amino acids one at a time in the ordered
sequence specified by the mRNA strand is
Answer:
tRNAs
Explanation:
tRNAs bring their amino acids to the mRNA in a specific order. This order is determined by the attraction between a codon, a sequence of three nucleotides on the mRNA, and a complementary nucleotide triplet on the tRNA, called an anticodon. This anticodon also specifies the particular amino acid that the tRNA carries. hope this helps you :)
Plants have specialized structures that help ensure reproduction. Which statement is an example of these structures?
A. An oak tree has thick bark.
B. A banana plant has green leaves.
C. Dandelion seeds blow in the wind.
D. Carrots grow underneath the soil.
The statement that best exemplifies specialized structures in plants is C: "Dandelion seeds blow in the wind."
This statement refers to the specialized structure of dandelion seeds, which have a feathery structure called a pappus that aids in dispersal through wind. Plants have evolved various specialized structures to ensure their reproduction and dispersal. In the case of dandelion seeds, their feathery pappus allows them to catch the wind and be carried away from the parent plant to new locations where they can germinate and grow.
This adaptation increases the chances of their survival and colonization in different areas. Specialized structures in plants can also include adaptations like bright flowers and sweet nectar to attract pollinators, thorns or spines for defense against herbivores, and underground storage organs like tubers or bulbs for nutrient storage and propagation.
These structures play crucial roles in the reproductive success and survival of plants in their respective environments, allowing them to disperse their offspring, attract pollinators, defend against threats, and establish themselves in diverse habitats. Therefore, Option C is correct.
Know more about specialized structures here:
https://brainly.com/question/18526471
#SPJ8
The pictures below show two types of telescopes.
Which of these statements is most likely true about the ability of the telescopes to gather radiations from distant objects in space?
A. Both the telescopes gather the same amount of radiations.
B. Neither of the telescopes gather sufficient amount of radiations.
C. The refracting telescope gathers more radiations than the reflecting telescope.
D. The reflecting telescope gathers more radiations than the refracting telescope.
The reflecting telescope gathers more radiation than the refracting telescope. Therefore, option (D) is correct.
Reflecting telescopes use mirrors to gather and focus light, allowing for larger apertures and higher light-gathering capabilities compared to refracting telescopes, which use lenses. This design difference typically gives reflecting telescopes an advantage in terms of gathering more radiation from distant objects in space.
However, without specific information about the sizes or specifications of the telescopes in the pictures, this inference is based on the general characteristics of reflecting and refracting telescopes.
Learn more about telescope, here:
https://brainly.com/question/556195
#SPJ1
Which of the following are examples of genetic drift?
(Choose all that apply)
A. Bottleneck effect
B. Founder Effect
C. Lamarck Effect
D. Equilibrium Effect
When a population is drastically reduced in number, genetic drift manifests itself most dramatically in a phenomenon known as the bottleneck effect, hence option A is correct.
What is genetic drift?Natural disasters (earthquakes, floods, and fires) can completely devastate a population, killing the majority of people and leaving just a few, haphazard survivors in their wake.
Genetic drift is a random process that can produce significant population changes quickly.
Therefore, regularly tiny population numbers and drastic population size decreases are known as "bottlenecks," hence option A is correct.
Learn more about the bottleneck effect, here:
https://brainly.com/question/3188869
#SPJ1
The hallux is oriented on this aspect of the foot
A. medial B. lateral C. posterior D. proximal E. inferior
10. (04.03 HC)
Which substances are needed for cellular respiration?
Use complete sentences to explain how the mass of hydrogen is conserved during cellular respiration. (10 points)
Chemical reactions that simulate cellular respiration follow the Law of Conservation of Matter when they are balanced. Six carbon atoms, 12 hydrogen atoms, and 18 oxygen atoms are the same number of atoms as the reactants. C₆H₁₂0₆+60₂ — 6C0₂+6H₂0 .
What is cellular respiration?Through the process of cellular respiration, organisms mix oxygen with food molecules, directing the chemical energy contained in these substances toward life-sustaining processes while excreting carbon dioxide and water as waste. Foods are broken down by organisms that do not require oxygen in a process known as fermentation.
What are atoms?A chemical element is uniquely defined by its atoms, which are small units of a substance. An atom is made up of a core nucleus and one or more negatively charged electrons that orbit it. The positively charged, comparatively hefty protons and neutrons that make up the nucleus may be present. The fundamental building components of matter are atoms. Atoms make up anything that has mass and occupies space.
To know more about cellular respiration, check out:
https://brainly.com/question/14158795
#SPJ1
QUESTION 4
Which material would not be required for determining the sequence of a 400 bp DNA fragment by the highthroughput sequencing method?
a. The four dNTPs (dATP, dCTP, dGTP, dTTP)
b. DNA polymerase
c. A short, artificially synthesized primer
d. A bacterial artificial chromosome
e. Heat-denatured DNA fragments
A potent tool for determining the sequence of a DNA fragment is the high-throughput sequencing technique. The DNA fragment is sequenced using particular primers after being amplified using PCR (polymerase chain reaction) in this procedure.
The four dNTPs (dATP, dCTP, dGTP, and dTTP), a brief primer made synthetically, and heat-denatured DNA fragments are needed in order to identify the sequence of a 400 bp DNA fragment.
Therefore, a bacterial artificial chromosome is the material that is not necessary for using the high-throughput sequencing technique to determine the sequence of a 400 bp DNA fragment. A cloning vector called a bacterial artificial chromosome (BAC) is used to clone large DNA segments in bacteria.
Learn more about DNA at:
https://brainly.com/question/30006059
#SPJ1
what are the names for the 2 wind systems where pressure belts meet called
Answer:
The two wind systems where pressure belts meet are called the "Polar Front" and the "Intertropical Convergence Zone (ITCZ)".
Explanation:
The chemiosmotic model requires an intact outer mitochondrial membrane. is supported by the observation that, when isolated mitochondria have an artificial electrochemical gradient (higher pH in the matrix) imposed on them, electrons spontaneously flow through the respiratory chain. is supported by the observation that isolated mitochondria that are actively respiring cause the pH of the solution they are in to increase. requires that mitochondrial ATP synthesis and electron flow through the respiratory chain be obligately coupled.
Answer:
requires that mitochondrial ATP synthesis and electron flow through the respiratory chain be obligately coupled.
Explanation:
The chemosmotic model was a concept formulated by Peter Mitchell, who stated that during the phases of electron transport in the respiratory chain, an intense release of energy occurs. This released energy allows hydrogen ions to be transported from within the mitochondrial matrix to the intercellular medium. The result of all of this is the occurrence of a chemosmotic gradient. However, when interpreting what occurs in the chemosmotic model, we can see that this model requires that the mitochondrial synthesis of ATP and the flow of electrons through the respiratory chain must be coupled.
Why should we work to protect estuaries? (Select all that apply.)
They collect nutrients that would otherwise be washed out to sea.
They serve as homes for sharks and jellyfish.
They provide a buffer against storms between the mainland and the sea.
They serve as homes for shellfish and other wildlife.
They provide a buffer against storms between the mainland and the sea.
What are estuaries?Estuaries are places that lie in between the mainland and the sea. An estuary serves as a point where salt water mixes with fresh water.
It is necessary to protect an estuary because they are very important in the ecosystem. They provide a buffer against storms between the mainland and the sea.
Learn more about estuaries: https://brainly.com/question/17564221
They provide a buffer against storms between the mainland and the sea.
They collect nutrients that would otherwise be washed out to sea.
They serve as homes for shellfish and other wildlife. I'm pretty sure those are the answers, hopefully it helps!
water, carbon Dioxide, energy, glucose, oxygen
Which of these is the food the plant is making?
water, carbon Dioxide, energy, glucose, oxygen
Question:Water and Carbon Dioxide
Chlorophyll can make food the plant can use from carbon dioxide, water, nutrients, and energy from sunlight. This process is called photosynthesis.#CARRYONLEARNING #STUDYWELLWhich sentence describes a difference between plant cells and animal cells?
A. Plant cells cannot reproduce because they have cell walls, while animals cells are able to reproduce.
B. Plant cells take in food from their environment, while animal cells produce food inside themselves.y
C. Plant cells contain organelles for structure and photosynthesis, which are not found in animal cells.
D. Plant cells contain no nucleus or complex organelles, while animal cells do.
Answer: a
Explanation:
Is the round-the-alimentary canal trip interesting? What are the classes of food that have been digested by and absorbed into the body? Are there any classes of food that leave the body undigested?
The process of a round-the-alimentary canal trip is very interesting. This is because it moves the food processed through the action known as Peristalsis.
What is an alimentary canal?The alimentary canal may be dfeined as the pathway through which food enters our body and moves out through the anus after digestion. It is a tube-like structure that starts from the mouth and ends in the anus. Humans are complex multicellular organisms.
The food contains three macronutrients that require digestion before it can be absorbed. They include fats, carbohydrates, and proteins. Through the process of digestion, these macronutrients are broken down into molecules.
Roughages, also known as dietary fibers are the type of carbohydrates, which are undigested by the body.
To learn more about the Alimentary canal, refer to the link:
https://brainly.com/question/881890
#SPJ1
What is used in PCR to break the hydrogen bonds between complementary nucleotides?
Answer:
Heat
Explanation:
Hydrogen bonds are heat sensitive so in pcr heat is use as tool to break them
Plants as well as brown, green, and red algae show a basic life cycle which involves the alternation of generations between a(n) egg and a sperm. seed and a cone. spore and pollen. megaspore and a microspore. sporophyte and a gametophyte.
Answer:
The correct answer is ''sporophyte and a gametophyte''
Explanation:
Plants have a diplohaplon life cycle: a haploid adult plant, called a gametophyte, and a diploid adult plant, called a sporophyte. In green algae, the two generations, sporophyte and gametophyte, are independent and generally the same size. This type of life cycle is found not only in many multicellular green algae, but also in brown algae and red algae. In vascular seedless plants, including ferns, gametophytes, although still independent, are smaller in size than sporophytes. In seed plants, the gametophytic generation is further reduced and is totally dependent on the sporophyte.
Using the information in the reading. Please complete the second (new) strand of DNA using the complementary base pairing rules. The first example has been completed for you.
When a DNA replicates, adenine pairs with thymine and guanine pairs with cytosine.
Based on the sequence of the template strand, an enzyme known as DNA polymerase adds new nucleotides to the expanding strand during DNA replication. The complementary base pairing rules dictate the order in which the nucleotides are added.
The double helix two strands split apart during DNA replication, with each strand acting as a model for the creation of a new complementary strand. Adenine (A), thymine (T), cytosine (C), and guanine (G) are the bases found in DNA. The complementary base pairing rules state that A will always pair with T and C will always pair with G.
b. Original strand- A G T C T A C G
Complementary strand- T C A G A T G C
c. Original strand- G C G T A T G A
Complementary strand- C G C A T A C T
Learn more about DNA polymerase at:
brainly.com/question/14315652
#SPJ4
I need help on This question I’ll give you brainliest
The change to the investigation that would remove the source of the error noticed by the scientist is to test a fourth group, in which the participants do not receive the mineral supplement (option A).
What is a controlled experiment?A controlled experiment is an experiment designed to replicate the main experiment in every way, except in respect of the one variable that is being tested, so as isolate the effect of that variable.
In other words, a control is introduced in the experimentation process. A control is group of test subjects left untreated or unexposed to the independent variable.
According to this question, a company is testing the effect of a mineral supplement on common cold. The experimental procedure is okay except that they didn't include a fourth group, which will serve as the control.
Learn more about control experiment at: https://brainly.com/question/32257330
#SPJ1
Which of these is an example of elemental carbon?
A.
Diamond
B.
Methane
C.
Proteins
The example of elemental carbon is diamond and it is pure form of carbon. Thus, option A is correct.
What is elemental carbon?Elemental carbon is pure form of carbon and it does not contain other elements and present in natural form. Due to this reason it is known as elemental.
In elemental form pure atoms are not attached to any other atom. Example is diamond which is allotrope of carbon in which there is only carbon atom attached to each other.
Methane and proteins are compounds consist of a combination of carbon and other elements and they are not come in category of elemental carbon.
Therefore,the example of elemental carbon is diamond and it is pure form of carbon. Thus, option A is correct.
Learn more about elemental carbon here:
https://brainly.com/question/15304687
#SPJ1
When one DNA molecule is replicated, the results in two DNA molecules. What is true of the second DNA molecule?a) it is twice sizeb) it is half sizec) it is identical or nearly identical to the first DNA moleculed) the sequence of the bases, from the top to bottom is opposite the sequence in the first DNA molecule
In DNA duplication, there are some enzymes that contribute to this process being possible, such as the enzyme DNA Polymerase.
DNA duplication is semi-conservative duplication, as a template of the old DNA strand is used to form a new strand.
Therefore, the second DNA molecule that was formed is identical or nearly identical to the first DNA molecule.
Alternative "C" is correct.
what is the most sensitive part of the malebody
brainliest get 50 points
a. What type of questions were the researchers asking in order to determine whether the wildlife
management techniques were effective? (3 points)
b. We’re the crossing structures successful? (2 points)
One of the queries that researchers may have posed to ascertain the efficacy of the wildlife management strategies is "Were the animal crossing structures successful?"
Thus, additional inquiries that researchers may have made include: Has the quantity of animal crossings structures increased after the structures were put in place? Have the structures at the crossings lessened the incidence of wildlife-vehicle collisions?
Additional inquiries that researchers may include: have the crossing structures had any unforeseen effects that could have changed animal behavior or fragmented their habitat? Have the animal crossing structures been more affordable than alternative methods of animal management?
Learn more about the animal crossing structures here:
https://brainly.com/question/26104395
#SPJ1
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt
Question 1 A heterozygous yellow-seeded plant is crossed with a homozygous yellow seeded plant. i. ii. Question 2 Complete the punnet square and write the genotypic and phenotypic ration for the possible offsprings. (3 marks) Genotypic ration Phenotypic ration What is the probability of having a pure breeding green seeded offsprings (2 marks) What is the probability of having a yellow-seeded plant in F2 generation, when a true breeder from F1 is crossed with a non-true breeding yellow seeded plant? (2 marks)
Answer:
Explanation:
To solve this problem, let's represent the heterozygous yellow-seeded plant as "Yy" and the homozygous yellow-seeded plant as "YY."
i. When crossing a heterozygous yellow-seeded plant (Yy) with a homozygous yellow-seeded plant (YY), we can set up a Punnett square to determine the possible offspring genotypes:
Y Y
y Yy Yy
y YY YY
ii. The genotypic ratio is 2:2 or 1:1 for the possible offspring genotypes: Yy and YY.
The phenotypic ratio is also 2:2 or 1:1 for the possible offspring phenotypes: yellow-seeded (YY and Yy).
Question 2:
To determine the probability of specific outcomes, we need additional information about the parental genotypes and their inheritance patterns. Please provide the genotypes of the true breeder from F1 and the non-true breeding yellow-seeded plant for a more accurate calculation.
Which of the following dimate zones can be found in HIGH latitudes?
•Marine West Coast
•Subarctic
•Tropical Rainforest
•Tundra
Answer:
subarctic
Explanation:
Answer:
Subarctic
Explanation:
High latitudes receive the least sunlight, creating cold climates, and a subarctic has a cold climate