what was a problem in the 1840s that was resolved by the invention of fertilizers?

Answers

Answer 1

The problem in the 1840s that was resolved by the invention of fertilizers was the declining fertility of agricultural soil.


During the 1840s, farmers faced the challenge of diminishing soil fertility due to continuous cultivation without adequate replenishment of nutrients. This led to reduced crop yields and agricultural productivity. However, the invention and use of fertilizers addressed this issue by providing essential nutrients to the soil, thereby improving its fertility and enabling higher crop yields. Fertilizers contain elements like nitrogen, phosphorus, and potassium, which are essential for plant growth and development. These nutrients are absorbed by the plants through their roots and contribute to their overall health and productivity. By adding fertilizers to the soil, farmers were able to replenish the depleted nutrients, ensuring healthier and more abundant harvests. The invention of fertilizers revolutionized agriculture by significantly increasing crop production and addressing the problem of declining soil fertility in the 1840s.

Learn more about Fertilizers: https://brainly.com/question/24196345

#SPJ11


Related Questions

Which best describes an adaptation that could be found in a fish that lives in a slow-flowing stream?
the ability to attract prey by glowing
extra gills, for oxygen extraction
O the ability to grow larger
extra fat, for warmth​

Answers

Cold blooded animal that  lives its whole life in the water and breathes with gills, lays eggs in the water, has fins and is covered with scales (ex. goldfish)please mark me as brainliest

Answer:

My best guess is B!!! Sorry if im wrong!!!

Explanation:

Hope this help!! <3

the relative concentrations of atp and adp control the cellular rates of ________________.

Answers

The relative concentrations of ATP and ADP control the cellular rates of metabolic processes.

Cellular respiration is the process that produces ATP in living organisms. It is the biochemical pathway that releases energy stored in food molecules and uses it to produce ATP from ADP and inorganic phosphate. The energy released in cellular respiration is used to power the activities of the cell.

The relative concentrations of ATP and ADP control the cellular rates of metabolic processes. ATP inhibits the rate of ATP-forming processes while it stimulates the rate of ATP-consuming processes. ADP, on the other hand, stimulates the rate of ATP-forming processes while it inhibits the rate of ATP-consuming processes. Therefore, a cell with higher ATP concentration will tend to consume ATP and produce ADP while a cell with higher ADP concentration will produce ATP.

Learn more about cellular respiration here:

https://brainly.com/question/29760658

#SPJ11

Describe two pieces of evidence that support the hypothesis that an asteroid impact was
responsible for the iridium anomaly.

Answers

Answer:A dust cloud from an asteroid impact would have killed marine plants requiring uninterrupted sunlight, but many were unaffected. The iridium deposits may have been spewed by volcanoes. ... The Chicxulub structure may be a volcanic sequence of late Cretaceous age, not an impact meltsheet of Cretaceous-Tertiary age.

Explanation:

there

You touch a hot stovetop by accident and quickly pull your hand away. The feeling of the hot temperature was carried from your hand to your spinal cord by what part of a reflex arc?
A. Sensory neuron
B. Dorsal root
C. Interneuron
D. Motor neuron

(I am stuck between A and C)

Answers

Explanation:

answer a sensory neuron

Sensory neuron

Its the best option trust me i passed. Biology with. 90 up

Read the newsela article and write 5-10 sentences explaining how Amiji performed the experiment.




People gather inside more during the winter. Being closer together makes it easier to catch colds from others. Viruses that cause colds and flu survive better in drier air.

Scientists didn’t know if cold weather helped people get sick. But on December 6, 2022, scientists published new research.


They explained that the immune system attacks viruses in the nose. The immune system is the cells and their responses that help the body fight off infection. And, they found that this attack works better when it’s warm out.

Nose Can Fight Off Bacteria

Mansoor Amiji is a pharmaceutical sciences professor. He works at Northeastern University. A pharmaceutical scientist develops drugs and medicines. In 2018, Amiji found that the nose can fight off bacteria. Nose cells spray a group of spheres. These spheres swarm and destroy bacteria inhaled through the nose. They stop viruses from attaching to cells in the nose.

Amiji compares it to a hornet’s nest. Hornets defend a nest from attack. The spheres defend against germs.

To follow up the 2018 research, Amiji set out to study viruses. He had two questions. One was whether the spheres attacked viruses, too. The second was if the spheres worked as well when it’s cold out.

To answer these questions, scientists needed cells from the nose. They used samples of nasal mucosa. This is a thin tissue that lines the nose. The scientists also had a test substance to mimic viruses. They exposed the test substance to the nose cells. Then, the nasal mucosa sent out spheres to attack the substance.

An Explanation For Why People Get Sick In Winter

To answer the second question, they divided the samples into two groups. One set of samples was kept at 98.6 degrees Fahrenheit (37 degrees Celsius). This is the same temperature as the human body. The second sample set was kept at 90 degrees Fahrenheit (32 degrees Celsius).

The second temperature was decided after a separate test. The scientists measured the temperature inside the nose at two different air temperatures. One air temperature was 73 degrees Fahrenheit (23 degrees Celsius). The other was 39 degrees Fahrenheit (4 degrees Celsius). The temperature in the nose dropped by about 9 degrees.

The nasal mucosa at body temperature fought off viruses well. The colder nose cells didn’t have the same response. They sent out fewer spheres. And those spheres didn’t work as well.

This could explain why people get sick in the winter. Now that scientists know this, there’s more research to do. They can find new ways to treat colds and flus. And they can find ways to boost attacks by the spheres.

Answers

Amiji performed the experiment by using samples of nasal mucosa to expose a test substance that mimics viruses to study the response of the nose cells in attacking viruses at different temperatures.

What is the name and role of the scientist who performed the experiment?

The scientist who performed the experiment is Mansoor Amiji, a pharmaceutical sciences professor at Northeastern University.

What did Amiji study in 2018 and how did it lead to his 2022 experiment?

In 2018, Amiji found that the nose can fight off bacteria through the use of spheres that destroy bacteria. This led him to study whether the same spheres also attack viruses and whether they work as well in cold temperatures, which he investigated in his 2022 experiment.

Learn more about mimics viruses here:

https://brainly.com/question/4199993

#SPJ1

Discuss the implications of neuroplasticity on the promise of treatments for injuries or conditions. Also, because the brain changes with experience, what does this mean for our own ability to break barriers we did not think were possible?

Answers

Answer:

Explanation: Neuroplasticity or brain plasticity is the ability of the brain to modify its connections or re-wire itself. Without this ability, any brain, not just the human brain, would be unable to develop from infancy through to adulthood or recover from brain injury.

a poison that prevents the transfer of electrons from the last [fe-s] cluster of complex i to coenzyme q is added to a suspension of actively respiring mitochondria. which of the following will be observed? a) atp production would be impaired due to the uncoupling of oxidative phosphorylation from electron transport. b) atp production would be reduced due to inhibition of the coq subunit of atp synthase. c) atp production would be reduced due to a decrease in the number of protons pumped out of the mitochondrial matrix. d) atp production would be halted completely due to the block in electron transport through the electron transport chain. e) atp production would be maintained at the normal rate due to functional overlap between complex i and complex ii.

Answers

ATP production would be halted completely due to the block in electron transport through the electron transport chain, option (d) is correct.

Complex I, also known as NADH dehydrogenase, is the first and largest enzyme complex in the mitochondrial electron transport chain. It transfers electrons from NADH to coenzyme Q (CoQ), which is an essential step for the generation of ATP through oxidative phosphorylation.

If a poison is added that specifically prevents the transfer of electrons from the last [Fe-S] cluster of Complex I to CoQ, it would effectively block electron transport through the entire electron transport chain. As a result, the flow of electrons would be disrupted, and the production of ATP, which relies on the electron transport chain, would be halted completely, option (d) is correct.

To learn more about ATP follow the link:

https://brainly.com/question/836184

#SPJ4

The correct question is:

A poison that prevents the transfer of electrons from the last [fe-s] cluster of complex I to coenzyme q is added to a suspension of actively respiring mitochondria. which of the following will be observed?

a) ATP production would be impaired due to the uncoupling of oxidative phosphorylation from electron transport.

b) ATP production would be reduced due to inhibition of the coq subunit of ATP synthase.

c) ATP production would be reduced due to a decrease in the number of protons pumped out of the mitochondrial matrix.

d) ATP production would be halted completely due to the block in electron transport through the electron transport chain.

e) ATP production would be maintained at the normal rate due to functional overlap between complex I and complex II.

Las plantas transforman la luz del sol a través de unas células llamadas: a) Estomas. b) Cloroplastos. c) Raíces. d)Clorofila.

Answers

Respuesta:

La respuesta correcta es: b) Cloroplastos.

Explicación:

Los cloroplastos son organelas que se encuentran en las células vegetales y son responsables de realizar el proceso clave para la supervivencia de estos seres vivos: la fotosíntesis.

La fotosíntesis consiste en la transformación de sustancias inorgánicas a materia orgánica gracias a la energía proveniente de la luz solar. Esta materia orgánica será utilizada para la producción de los nutrientes requeridos por las células de la planta.

Los cloroplastos constan de una envoltura conformada por dos membranas y por unas vesículas llamadas tilacoides donde se encuentran las moléculas que participan en la transformación de energía lumínica a energía química que ocurre durante la fotosíntesis, por ejemplo la clorofila (que es un pigmento verde que le da a la planta su característico color).

a baby turtle growing into an adult that appears similar is an example of

Answers

The answer is Direct Development!!

After doing an endospore staining procedure on an unknown bacteria, you looked at it under the microscope and saw the picture below. What can you conclude?Vegetative cells are present, but no endosporesEndospores are present, but no vegetative cellsBoth endospores and vegetative cells are presentThe bacilli in the photo are acid fast

After doing an endospore staining procedure on an unknown bacteria, you looked at it under the microscope

Answers

From the photo, it can be concluded that there are both endospores and vegetative cells present. The endospores can be seen as smaller cells staind in blue, while vegetative celles are staind in red.

Lyme disease is an example of a(n) ______ infectious disease, because it is only seen in areas of the US where the tick vector for the pathogen is found.

Answers

Lyme disease is an examples of vector borne infectious disease.

What is Lyme disease?

Lyme disease is also called Lyme borreliosis, is an example of a vector-borne disease whose causative agent is Borrelia bacterium and it is transmitted by tick in the genus Ixodes. The common sympyoms of the infection is red rash, known as erythema migrans, which appears at the site of the tick bite.

Therefore, Lyme disease is an examples of vector borne infectious disease.

Learn more about Lyme disease below.

https://brainly.com/question/1322099

Lyme disease is a disease transmitted by the bite of an infected tick and is an example of an endemic infectious disease.

What is an endemic infectious disease?

It refers to the constant presence and/or habitual prevalence of a disease or an infectious agent in a population of a geographic area.

Lyme disease is a borreliosis transmitted by ticks of the genus Ixodes that seems to be limited to certain geographic areas of the US, therefore it is considered endemic.

Therefore, we can conclude that Lyme disease is a disease transmitted by the bite of an infected tick and is an example of an endemic infectious disease.

Learn more about Lyme disease here: https://brainly.com/question/15055276

One of the largest and oldest organisms on earth is located in fish lake and nation, forest, in utah.pando is an 80,000 year old grove of aspen trees that cover 100 acres. Although it looks like a forest, DNA analysis of several of the trees has confirmed it is really just one huge organism. Therefore the trees must have been reproduced

Answers

Pando aspen grove in Utah is an immense, genetically identical organism consisting of interconnected aspen trees spanning 100 acres and estimated to be around 80,000 years old.

One of the largest and oldest organisms on Earth, known as Pando, is located in Fish Lake National Forest in Utah. Pando aspen grove is an 80,000-year-old grove of aspen trees that covers approximately 100 acres. While it appears to be a forest, DNA analysis of several of the trees has revealed that they are genetically identical, confirming that Pando is actually one immense organism. The trees of Pando have been reproduced through a process called vegetative reproduction, where new shoots and stems emerge from the existing root system. This unique reproductive strategy has allowed Pando to persist and expand over thousands of years, making it a remarkable example of the interconnectedness and longevity of living organisms.

For more questions on Pando aspen grove:

https://brainly.com/question/29601096

#SPJ8

Which type of receptors do steroid hormones generally employ? O G-protein coupled receptors O enzyme-coupled receptors nuclear receptors O ion-channel coupled receptors What type of cell response would take the longest amount of time (on the scale of minutes to hours) to execute? one that involves the release of secretory vesicles one that stimulate lamellipodia formation by regulating the actin cytoskeleton one that involves a change in gene expression one that uses a phosphorylation event to activate an enzyme

Answers

The type of cell response that would take the longest amount of time to execute would be one that involves a change in gene expression.

This is because gene expression is a complex process that requires the transcription of DNA into mRNA and the subsequent translation of this mRNA into proteins.

This process can take anywhere from minutes to hours to complete, depending on the complexity of the gene, the amount of related proteins, and the availability of necessary materials for transcription and translation.

Additionally, the regulation of gene expression is a highly regulated and coordinated process, further adding to the time required for this type of cell response.

In comparison, other types of cell responses such as the release of secretory vesicles, the stimulation of lamellipodia formation, or the use of phosphorylation events to activate an enzyme, are faster and can be completed in minutes or even seconds.

Know more about phosphorylation here

https://brainly.com/question/31115804#

#SPJ11

if a agg in the trna anticodon pairs with a ucu (instead of with a ucc) in the mrna codon:

Answers

If an AGG in the tRNA anticodon pairs with a UCU instead of a UCC in the mRNA codon, it will result in a different amino acid being added to the growing polypeptide chain during protein synthesis.

This is because the genetic code is specific, and each codon (three nucleotides in the mRNA sequence) codes for a specific amino acid. The anticodon of the tRNA is complementary to the codon in the mRNA, and when they pair up, the amino acid carried by the tRNA is added to the polypeptide chain. In this case, AGG normally pairs with UCC, which codes for the amino acid serine. However, if AGG pairs with UCU instead, it will code for a different amino acid called leucine. This change in amino acid sequence can have significant effects on the structure and function of the protein being synthesized.

To know more about anticodon visit:

https://brainly.com/question/16552442

#SPJ11

2Na + Cl2 → 2NaCl

Is the chemical reaction Endo or exothermic

Answers

The chemical reaction \(2Na + Cl_2 \rightarrow 2NaCl\) is exothermic. This is because it releases energy in the form of heat during the reaction.

When the two elements, sodium (Na) and chlorine (\(Cl_2\)), react with each other, they form sodium chloride (NaCl) which is an ionic compound. This reaction involves the transfer of electrons from sodium to chlorine, forming ionic bonds between the two elements to make sodium chloride. Since the formation of NaCl releases energy in the form of heat, it is an exothermic reaction. An exothermic reaction is a reaction that releases energy in the form of heat, light, or sound. In this case, energy is released in the form of heat. The amount of energy released during the reaction is called the heat of reaction. The heat of reaction for this reaction is negative, which means that energy is being released. In summary, the chemical reaction \(2Na + Cl_2 \rightarrow 2NaCl\) is an exothermic reaction because it releases energy in the form of heat. The formation of NaCl involves the transfer of electrons and the formation of ionic bonds between the two elements. The energy released during the reaction is negative, which indicates that energy is being released.

For more questions on exothermic

https://brainly.com/question/2532798

#SPJ8

the function of hormone x is to increase blood calcium levels. according to the principles of negative feedback what is the stimulus for the secretion of homrone x

Answers

The stimulus for the secretion of hormone X, which functions to increase blood calcium levels, is a decrease in blood calcium levels.

The regulation of hormone X secretion follows the principles of negative feedback. Negative feedback is a mechanism by which the body maintains homeostasis by counteracting any deviations from the normal range of a particular variable. In this case, the variable being regulated is blood calcium levels.

1. Set point: The body has a specific set point for blood calcium levels that it aims to maintain. Let's assume this set point is within a normal range.

2. Decrease in blood calcium levels: If blood calcium levels drop below the set point, it acts as a stimulus for the secretion of hormone X.

3. Activation of the feedback mechanism: The decrease in blood calcium levels triggers specialized cells, such as parathyroid cells, to detect the deviation from the set point.

4. Secretion of hormone X: In response to the low blood calcium levels, hormone X is secreted by the parathyroid glands. Hormone X (in this case, parathyroid hormone or PTH) acts on target tissues such as bone, kidneys, and intestines to increase calcium absorption and release from bone, enhance calcium reabsorption in the kidneys, and stimulate the production of active vitamin D, which promotes calcium absorption in the intestines.

5. Increase in blood calcium levels: As a result of hormone X's actions, blood calcium levels increase, eventually reaching the normal range or set point.

6. Negative feedback loop: Once blood calcium levels return to the normal range, the stimulus for hormone X secretion (i.e., low blood calcium levels) is removed, and the secretion of hormone X is inhibited. This negative feedback loop helps maintain the stability of blood calcium levels within the desired range.

In summary, the stimulus for the secretion of hormone X, which increases blood calcium levels, is a decrease in blood calcium levels. This triggers the secretion of hormone X, leading to actions that raise blood calcium levels back to the normal range, ultimately completing the negative feedback loop.

To know more about blood calcium levels refer here:

https://brainly.com/question/30742811#

#SPJ11

Life: Scientists have found signatures of life in
rocks from 3.5 billion years ago. That means life
existed in a world with very low oxygen! What
is the evidence?

Answers

Answer:The evidence to this is because oxygen, is produced by bacteria at that time! If they do That why would they need to use any oxygen? If i didn't get the answer you were asking then well sorry :/

Epinephrine increases available glucose by binding to a cell surface receptor that activates a G protein, which then activates cAMP-dependent protein kinase, then phosphorylase kinase, and finally glycogen phosphorylase, which breaks down glycogen into glucose-1-phosphate. Epinephrine breaks down glucose by activating five different proteins, stimulating glycogen synthase. Experimentally, you discover that in addition to stimulating the G protein, the epinephrine receptor can also directly stimulate glycogen synthase, bypassing the intermediate proteins. This would be an example of

Answers

The epinephrine receptor directly stimulating glycogen synthase, bypassing the intermediate proteins would be an example of a signal transduction pathway or cascade.

Epinephrine activates a G protein that activates cAMP-dependent protein kinase, phosphorylase kinase, and finally glycogen phosphorylase which breaks down glycogen into glucose-1-phosphate. Epinephrine also stimulates glycogen synthase and the epinephrine receptor can directly stimulate glycogen synthase, bypassing the intermediate proteins. Thus, the process would be an example of a signal transduction pathway or cascade.

Signal transduction is the process of cell communication that involves the conversion of extracellular signals (like epinephrine) to intracellular signals that ultimately lead to a cellular response. The pathway or cascade consists of a series of proteins that transmit the signal from the receptor to the effector molecule, which in this case, is glycogen synthase.

To know more about epinephrine click here:

https://brainly.com/question/31116264

#SPJ11

What organic compound is used in order to break bonds between the nitrogenous bases so replication can occur

Answers

For bacterial DNA replication to begin, the supercoiled chromosome is relaxed by topoisomerase II, also called DNA gyrase. An enzyme called helicase then separates the DNA strands by breaking the hydrogen bonds between the nitrogenous base pairs.

Cardiac muscle causes movement in the .

a
bone
b
tendon
c
ligament
d
organ

Answers

d forgive me if im wrong!

It would be heart but heart is not a answer choice so D.


3.How are organisms grouped into producers, consumers, and decomposers?
Where do you fall

Answers

Answer:

Food webs are models to show how organisms are related in an ecosystem based on how they get their energy. The main roles are producers, consumers, and decomposers?

Explanation:

Producers

Producers make their own energy through photosynthesis. All most all plants, But not all, are Producers.

Consumers can be divided into

Primary > Primary consumers get energy by eating producers. They are usually small animals, insects and herbivores.Secondary > Secondary consumers get energy eating primary consumers. Secondary consumers are usually predators.Tertiary > Tertiary consumers get energy by eating secondary consumers. Owls and birds of prey, bears and large predator's, and carnivores are usually tertiary consumers. Humans are also among the tertiary consumers.

And lastly Decomposers

Decomposers get by breaking down dead organisms and returning nutrients to the soil. Decomposers are usually fungi-like-mushrooms and bacteria

12. Rabies is transmitted from animals to humans, so it's an example of what kind of disease?
O A. Zoonotic
O B. Variolated
O C. Incurable
O D. Fatal

Answers

A. Zoonotic
Zoonoses (plural) are diseases that are transmitted between animals to humans. It can also transmit from humans to animals
The anwser would be a zoonotic

Question 14 (2 points) The process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called natural selection. O mutation. genetic drift. migration.

Answers

The process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called a mutation.

A mutation is a sudden and lasting alteration in the DNA sequence that can influence genetic variation. Changes in the DNA sequence can influence phenotype, which may or may not have an effect on an organism's fitness. Mutations occur spontaneously, either from errors in DNA replication or from exposure to mutagenic agents. Mutations may happen in either coding or non-coding regions of the DNA, and they can be either silent or expressed.

Evolution is a natural process that results in the gradual change of inherited characteristics in populations over generations. It is the process of alteration in the inherited characteristics of species over successive generations. In other words, it is the process of gradual changes that happen to species over time as they adapt to their environments. It can be defined as a change in the gene frequency in a population over time.

Types of Evolution 1. Natural Selection 2. Genetic Drift 3. Gene Flow 4. Mutation 5. Non-Random Mating 6. Admixture 7. Mutation Pressure 8. Genetic Draft 9. Bottleneck and Founder Effect 10. Sexual Selection the process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called a mutation.

To learn more about DNA sequence here

https://brainly.com/question/31650148

#SPJ11

2 3 4 Mark this and return H G 5 Which organelle is labeled I? F 10 Mitili A Save and Exit DELL B E C Next 57:10 Submit Sign out​

Answers

In the provided diagram, where the organelle labeled "I" is the chloroplast, it signifies the presence of a crucial organelle within plant cells.

Chloroplasts are unique and essential structures responsible for the process of photosynthesis. This intricate process allows plants to convert light energy from the sun into chemical energy in the form of glucose, while also releasing oxygen as a byproduct.

Chloroplasts possess a distinctive double membrane structure. The inner membrane surrounds the stroma, a semi-fluid matrix containing enzymes, DNA, and ribosomes. Within the stroma, a system of interconnected membranous sacs called thylakoids is present. These thylakoids are organized into stacks called grana, and they contain the pigment chlorophyll.

Chlorophyll is the key player in photosynthesis as it absorbs light energy. When light is absorbed, chlorophyll initiates a series of chemical reactions in the thylakoid membranes, resulting in the conversion of light energy into chemical energy.

This energy is used to generate ATP (adenosine triphosphate) and NADPH (nicotinamide adenine dinucleotide phosphate), which are crucial for the synthesis of glucose.

Overall, chloroplasts are key organelles that enable plants to capture and convert sunlight into energy-rich molecules, ultimately sustaining life on Earth.

Their structural organization, containing chlorophyll and facilitating photosynthesis, illustrates the remarkable adaptation of plants to their environment and their vital role in global ecosystems.

Know more about  Chloroplasts    here:

https://brainly.com/question/1741612

#SPJ8

The complete question is :

Consider this plant cell.

Which organelle is labeled I?

2 3 4 Mark this and return H G 5 Which organelle is labeled I? F 10 Mitili A Save and Exit DELL B E C

How are meiosis and mitosis different?

Answers

Answer:

to sum it up:  Mitosis is a.s.e.x.u.a.l, while meiosis is s..x.u.a.l.

Explanation:

another example: In meiosis, daughter cells possess only half the chromosomes of the original cells; while in mitosis the number of chromosomes is the same in both mother cells and daughters.

What is the source of carbon for terrestrial plants? terrestrial plants acquire carbon from the .

Answers

During this process, plants cleave the carbon from the two oxygen molecules and terminate the oxygen back into the surrounding circumstances.

What is terrestrial plants?In terrestrial communities, plants transform atmospheric carbon dioxide into carbon-based combinations through photosynthesis (see above The photosynthetic operation). During this process, plants cleave the carbon from the two oxygen molecules and terminate the oxygen back into the surrounding circumstances.Many terrestrial manufacturers are not even helophytes but rainforest species that tolerate occasional inundation. Examples of these types of plants contain Syngonium, Philodendron, Adiantum, Aglaodorum, Aglaonema, Cordyline, Ophiopogon, and Physostegia.Terrestrial manufacturers are defined as any manufacturer that grows on, in, or from the land. By contrast, aquatic plants are manufacturers that thrive when their roots are submerged in moisture.

To learn more about terrestrial plants, refer to:

https://brainly.com/question/29594

#SPJ4

PLEASE TRANSCRIBE-

GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

GACCAAAUGGUAGCUAACUUUUGCAAUUUAGGUCAAAGGUA

Explanation:

I assume you want to transcribe the DNA sequence into mRNA. To do that, you need to replace each T with a U and keep the other bases the same. The mRNA sequence would be:

GACCAAAUGGUAGCUAACUUUUGCAAUUUAGGUCAAAGGUA

Congratulations, you have just performed transcription, the process of copying a segment of DNA into RNA. You have also created a messenger RNA (mRNA) molecule, which can encode a protein. But don't get too excited, because your mRNA is not ready for translation yet. You still need to process it by adding a 5' cap and a poly-A tail, and splicing out any introns. And even then, you might not get the protein you want, because there are many factors that affect gene expression, such as transcription factors, RNA interference, and epigenetic modifications. So don't think that transcription is a piece of cake. It's actually a complex and highly regulated process that involves many enzymes and molecules. But hey, at least you got the first step right!

Layers of bony matrix at the outer and inner surfaces of bone and covered by the periosteum and the endosteum are:
A) concentric lamellae.
B) osteons.
C) Haversian systems.
D) interstitial lamellae.
E) circumferential lamellae.

Answers

The correct option is E; circumferential lamellae , The circumferential lamellae are bony matrix layers that run around the circumference of the bone.

The inner circumferential lamellae are found on the inner side of the endosteum-covered compact bone tissue. The outer circumferential lamellae are located on the periosteum-covered outside. Bone is made up of three types of cells: osteoocytes, osteoblasts, and osteoclasts, as well as a highly calcified intercellular bone matrix. The outer surface of bone is covered by periosteum, which is attached to bone by Sharpey's fibers, and the inner bone surface is lined with endosteum.

Learn more about  circumferential lamellae ,

https://brainly.com/question/12906685

#SPJ4

Question 13 (1 point) Saved
Which of the following best describes passive cellular transport?
up a concentration gradient
down a concentration gradient
low concentration to high concentration
needs additional energy

Answers

Answer:

it doesn't need additional energy

Explanation:

Passive transport is a movement of ions and other atomic or molecular substances across cell membranes without need of energy input. Unlike active transport, it does not require an input of cellular energy because it is instead driven by the tendency of the system to grow in entropy

true or false: the hilum is defined as a depression and slit on the medial aspect of the kidneys; and the site where blood vessels, nerves and lymphatic vessels enter and leave.

Answers

The statement "the hilum is defined as a depression and slit on the medial aspect of the kidneys; and the site where blood vessels, nerves, and lymphatic vessels enter and leave" is True because the renal hilum contains kidney structures.

The renal hilum is the place where structures that provide services to the kidneys, such as arteries, nerves, lymphatics, and ureters, enter and exit the kidney. The hila that are facing medially are tucked into the convex and sweeping contour of the cortex. The renal pelvis, which is composed of both the main and minor calyxes found in the kidney, emerges from the hilum of the kidney. So the statement is true.

You can also learn about renal hilum from the following question:

https://brainly.com/question/13257014

#SPJ4

Other Questions
An isolated island has a population of 1000 inhabitants. A contagious disease is reported to have been contracted by 10 of them who have just returned from a city tour. If the disease spreads to a total of 10% of the population in one week, solve the Gompertz model of the form = kP(Pmax In P) for the epidemic. Based from the model, 4.1. What is the rate of spread k of the disease? 4.2. When will 50% of the population have the disease, assuming no cure is found? dP = dt find an equation of the tangent to the curve at the point corresponding to the given value of the parameter. x = t t1, y = 6 t2, t = 1 Ornithine transcarbamylase deficiency (OTD) in humans is an X-linked recessive disorder that produces mental deterioration and early death if not properly treated. If a healthy woman whose father has OTD marries a man who does not have OTD, what is the probability they will have a daughter with OTD using p/3=s what is the side length of an equilateral triangle that has a perimeter of 24.6 cm Find the angle between the vectors. (First find an exact expression and then approximate to the nearest degree.) a = (2,0,4), b = (2, -1,0) = exact O approximate a police officer who walks up and talks to a person standing on the street corner, questioning the person about his drug use, is engaged in your patient is taking belatacept and develops posttransplant lymphoproliferative disorder (ptld). you would expect to see ____________ is a city more than twice as large as the next in an urban system and a cultural, political, and economic center Complete the following sentences with the appropriate reflexive pronoun.levanta temprano, y ellamaquillo muy poco, pero mi madre y mimaquillan mucho.vistes muy elegante, y nosotros1. El2. Yohermana3. Telegante tambin.levanta tarde.vestimos alex was recently found guilty of first-degree murder. based upon state law, the judge was forced to sentence alex to 25 years in prison. alex will serve his time in a prison approximately 100 miles from his home. because alex will not be able to harm anyone in the general public, his removal from society is called Recently you attended a presentation by Dr Alex, renowned entrepreneur and businessleader, who spoke at length about the development of an accounting information systemsand, what he referred to as the life cycle approach. After the presentation you returnedto your workplace and discussed the virtues of this approach with your boss, Lance.Lance was extremely interested because he has become aware that the current accountinginformation systems is inadequate for the developing needs of the business. He asked youto do a number of things for him in your new role as the Accounting InformationSystems Development Officer.1. Write a brief report identifying the role that would be expected of the managementteam in the development and design of a new accounting information system. Theunderlying issue is really the role you would expect Lance "your boss" to play.2. Would you expect that the people who will use the new system should have a role inany analysis leading up to, in the selection of and implementation of the new accountinginformation system should one be selected?3. Write a clear and comprehensive report on what would be involved in the adoption ofa life cycle approach to adopting a new accounting information system. Specificallyidentify the stages that would need to be engaged in, and staff likely to be involved. Lance,your boss, also wishes to know whether consultant costs would be incurred? Antibody binding to receptors on the thyroid may result in DiGeorge syndrome. type I diabetes. multiple sclerosis. autoimmune hemolytic anemia. Graves' disease. Use the given area of the base and the height to find the volume of the right rectangular prism, in cubic units. what is the concentration of a stock solution in mg/ml and g/ml if the totalconcentration was 8g/l? show your work What did president john f. kennedy have in common with his predecessor, dwight d. eisenhower? for the cross bbbb , what is the expected genotype ratio? The admission fee at an amusement park is $1.50 for children and $4 for adults. On a certain day, 318 people entered the park, and the admission fees collected totaled 952.00 dollars. How many children and how many adults were admitted? entries for note collected by bank accompanying a bank statement for borden company is a credit memo for $26,390 representing the principal ($26,000) and interest ($390) on a note that had been collected by the bank. the company had been notified by the bank at the time of the collection but had made no entries. journalize the entry that should be made by the company to bring the accounting records up to date. if an amount box does not require an entry, leave it blank. You have 25 coupons for the hotel A, and 20 coupons for the hotel B. What is the maximum number of coupons for the hotel C that you can use if you are not allowed to spend two consecutive nights at the same hotel? How would I set up an equation to solve this problem? Which of the following is concerned with monitoring estimates of present performance and predictions of future performance?Select one:a. Content validityb. Predictive validityc. Concurrent validityd. Construct validity