When would you use an acid fast stain outline the basic steps in
carrying out an acid fast stain

Answers

Answer 1

An acid-fast stain is used to detect bacteria that have a waxy cell wall, such as Mycobacterium species, which include the causative agents of diseases like tuberculosis and leprosy.

An acid-fast stain is employed when there is a need to identify bacteria that possess a waxy lipid-rich cell wall, such as the Mycobacterium genus. These bacteria have unique characteristics that make them resistant to conventional staining methods. Acid-fast staining is particularly useful in diagnosing diseases caused by acid-fast bacteria, such as tuberculosis and leprosy.

The basic steps involved in carrying out an acid-fast stain include:

1. Preparation of the bacterial smear: A thin film of the bacterial sample is spread on a microscope slide and allowed to air-dry.

2. Application of the primary stain: The slide is flooded with a primary stain called carbol fuchsin, which contains a basic dye (fuchsin) and a lipid-soluble agent (phenol). The slide is then gently heated to enhance the penetration of the stain into the bacterial cells.

3. Decolorization: The slide is rinsed with an acid-alcohol solution (usually 3% acid-alcohol) to remove the stain from non-acid-fast bacteria. Acid-fast bacteria retain the stain due to their waxy cell wall.

4. Counterstaining: The slide is then treated with a contrasting stain, such as methylene blue or brilliant green, to stain the non-acid-fast bacteria that were decolorized.

5. Microscopic examination: The stained slide is observed under a microscope, where acid-fast bacteria will appear as red or pink rods, while non-acid-fast bacteria will appear blue or green.

By following these steps, an acid-fast stain can effectively identify acid-fast bacteria and aid in the diagnosis of related infectious diseases.

Learn more about bacteria here:

https://brainly.com/question/15490180

#SPJ11


Related Questions

When describing a community, a biologist would identify every

Answers

When describing a community, a biologist would identify every component or characteristic of a biological community.

A biological community refers to a group of different populations that inhabit a particular geographical area and interact with one another. Biologists would observe different aspects of a community, including the organisms’ ecological roles, population size, distribution, and diversity. In addition, a biologist would also consider the types of relationships between different organisms in the community, including competition, predation, mutualism, and parasitism.

In terms of population size and distribution, a biologist would examine the population density of each species in a community, as well as the spatial arrangement of organisms. This information is essential in understanding how the different populations interact with each other. For instance, organisms with higher population densities may compete for limited resources, such as food and water.

In terms of ecological roles, biologists would identify the trophic structure of a community. This involves understanding the flow of energy through different levels of the food chain, including producers, consumers, and decomposers. Biologists would also observe how different species play unique ecological roles, such as pollination or seed dispersal.

Overall, a biologist would consider every component and characteristic of a community when describing it. By doing so, they can gain a comprehensive understanding of how different species interact and function within a particular ecosystem.

Know more about biological community here :

brainly.com/question/27739812

#SPJ8

Final answer:

A biologist describes a community as the various species within an area, their interrelationships and their interactions with the environment. This includes various populations and the ecosystem they form, which are part of the broader biosphere.

Explanation:

When describing a community, a biologist would identify every organism that makes up the populations in a specific area. This includes the organisms, their interactions, and their relation with the environment. For instance, in a forest, each pine tree, representing an organism, together forms a pine tree population. Different populations such as pine trees, flowering plants, insects, and microbial populations combine to create the forest community. The ecosystem encompasses these living organisms and non-living components like nitrogen in the soil or rainwater. Altogether they are part of the biosphere, collectively representing zones of life on Earth.

Learn more about Community here:

https://brainly.com/question/29811467

#SPJ12

there are two incomplete-dominant alleles for petal color in a population of flowers. 36% of the flowers have red petals, 16% of the organisms have white petals, and 48% of the flowers have pink petals. what percentage of alleles in this population code for red petals (r)? [only include number, no symbols such as %]

Answers

In the case when 36% of the organisms have white petals and 48% have pink petals, that leaves 16% of the organisms with red petals.

One of two or more variations of the DNA sequence (a single base or a segment of bases) at a certain genomic region is referred to as an allele. For each given genomic site where such variation exists, an individual inherits two alleles, one from each parent.

The term "allele frequency" or "gene frequency" refers to the relative frequency of an allele (gene variation) at a particular locus in a population, given as a fraction or percentage.

Accordingly, the following formula may be used to determine the proportion of alleles in this population that represent red petals:

100 - 36 - 48 = 16%

Therefore, 16% of the population's alleles are red-petal alleles (R).

Learn more about alleles here:

brainly.com/question/23516288

#SPJ4

pth promotes the formation of which hormone?view available hint(s)for part bpth promotes the formation of which hormone?thyroid hormonescalcitonincalcitriolvitamin d

Answers

PTH (parathyroid hormone) promotes the formation of calcitriol, which is the active form of vitamin D.

Parathyroid hormone (PTH) plays a critical role in maintaining calcium and phosphate balance in the body. One of its key functions is to promote the formation of calcitriol, the active form of vitamin D. Calcitriol is synthesized in the kidneys from calcidiol (25-hydroxyvitamin D) through the action of the enzyme 1-alpha-hydroxylase.

When blood calcium levels are low, the parathyroid glands release PTH. PTH stimulates the activity of 1-alpha-hydroxylase in the kidneys, leading to the conversion of calcidiol into calcitriol.

Calcitriol, as an active hormone, exerts various effects to increase blood calcium levels. It enhances the absorption of dietary calcium and phosphate from the intestines, promotes the reabsorption of calcium in the kidneys, and stimulates the release of calcium and phosphate from bones.

To know more about parathyroid hormone:

https://brainly.com/question/12961036

#SPJ11

Active Transport Active transport moves substances from a more d_______ solution to a more c (against the c This requires e solution g from Active transport allows m__________ to be absorbed into plant root hairs from very d solutions in the soil. It also allows sugar molecules to be absorbed from ________ concentra- tions in the gut into the blood which has a higher sugar concen- tration. Sugar molecules are used for cell r​

Answers

Active transport moves substances from a more dilute solution to a more diluted solution (against the concentration gradient). This requires energy from the cell. Active transport allows mineral ions to be absorbed into plant root hairs from very dilute solutions in the soil. It also allows sugar molecules to be absorbed from lower concentrations in the gut into the blood, which has a higher sugar concentration. Sugar molecules are used for cell respiration and other cellular processes.

Active transport moves substances from a more dilute solution to a more concentrated solution, against the concentration gradient. This requires energy expenditure by the cell.

Active transport allows minerals to be absorbed into plant root hairs from very dilute solutions in the soil. It also enables sugar molecules to be absorbed from lower concentrations in the gut into the blood, which has a higher sugar concentration. Sugar molecules are used for cellular respiration and other metabolic processes in cells.

Place the parts to show how energy flows

Owl, sun, mouse, grass

Answers

Answer:

sun -> grass -> mouse -> owl

Explanation:

Energy flows from the Sun to producers and then to consumers. Each gets energy from the other by eating them or photosynthesis.

Sun grass mouse owl because sun is energy to the grass and a mouse is energy to the owl

In carnations, the alleles for flower color exhibit incomplete dominance. Red
flowers have the RR genotype. Pink flowers have the RW genotype. White
flowers have the WW genotype.

If a red flower and a pink flower are crossed, what is the expected genotypic
ratio of their offspring?

A. 2 RR:2 RW:0 WW
B. 1 RR: 3 RW:0 WW
C. O RR:2 RW: 2 WW
D. 1 RR:2 RW: 1 WW

Answers

In the case of incomplete dominance in carnations, the genotypic ratio of the offspring resulting from a cross between a red flower (RR genotype) and a pink flower (RW genotype) would be:

D. 1 RR:2 RW: 1 WW

This means that for every offspring, there would be one with the RR genotype (red flower), two with the RW genotype (pink flower), and one with the WW genotype (white flower).

what type of organism eats all producers and consumers and all trophic levels?

Answers

Answer:Omnivore

Explanation:

Answer:

omnivores

Explanation:

animals that eat both plants and other animals are called omnivores.

How much oxygen does the respiratory system remove from the air?
A. 22%
B. An amount in proportion to the body's needs
C. An amount we determine consciously as we breathe
D. 100%

Answers

The amount of oxygen removed by the respiratory system from air is the amount in proportion to the body's needs (option B).

How is oxygen removed during respiration?

Cellular respiration is the process by which cells obtain chemical energy by the consumption of oxygen and the release of carbon dioxide.

When we exhale, the composition of the air remains almost the same as the air we inhale, only the percentage of carbon dioxide and oxygen changes.

The amount of inhaled air contains 21% of oxygen and 0.04% of carbon dioxide, while the air we breathe out contains 16.4% of oxygen and 4.4% of carbon dioxide.

This means that the respiratory system has removed the amount of oxygen proportional to the amount the body needs.

Learn more about respiration at: https://brainly.com/question/22182638

#SPJ1

Bent little finger (B) is dominant over straight little finger (b). A student has bent little finger, but their Mom has straight little finger. Without even knowing the Dad's phenotype, what is the student's genotype? O a. BB Ob. Bb O c. bb O d. There is no way to be sure, because we don't know Dad's genotype. Value: 2 Widow's peak is dominant over lacking a widow's peak. Sophia has a widow's peak, just like both her parents. Are we sure she is PP? O a. Yes, she is PP because both parents have the dominant trait. O b. No, there is still a chance she could be Pp. That might occur if either parent was Pp. O c. No, she could be PP, Pp, or pp. All are possible depending on her parent's genotypes. Value: 2 Dark brown eyes (B) are dominant over light colored eyes (b). A student has blue eyes (light), but she is adopted. Do we know her genotype? O a. BB O b. bb O c. There is no way to be sure without knowing the genotype of at least one of her parents. O d. Bb

Answers

The student's genotype is either Bb or BB.

Based on the given information, we know that a bent little finger (B) is dominant over a straight little finger (b). The student has a bent little finger, indicating that they possess the dominant trait. However, since we do not know the genotype of the student's father, we cannot determine the exact genotype of the student.

If the student's mother has a straight little finger (bb), then the student must have inherited the bent little finger allele from their father. In this case, the student's genotype would be Bb, with one copy of the dominant allele and one copy of the recessive allele.

On the other hand, if the student's mother has a bent little finger (Bb or BB), the student could have inherited either a dominant allele from the mother (BB) or one copy of the dominant allele from the mother and one copy of the recessive allele from the father (Bb). Therefore, the student's genotype could be either BB or Bb.

In conclusion, without knowing the genotype of the student's father, we cannot determine the exact genotype of the student. However, based on the given information, the student's genotype is either Bb or BB.

Learn more about genotype

brainly.com/question/14928544

#SPJ11.

Was combustion part of the carbon cycle before humans used fossil fuels?

Answers

Yes, combustion was indeed part of the carbon cycle before humans began using fossil fuels. Combustion is a natural process that involves the rapid reaction of carbon-containing substances with oxygen, resulting in the release of energy, carbon dioxide (CO2), and water (H2O).

Prior to human influence, combustion primarily occurred through natural processes such as wildfires and volcanic eruptions. These events released carbon dioxide into the atmosphere as a natural part of the carbon cycle.

Additionally, biological processes such as respiration by living organisms, including plants and animals, also contributed to the release of carbon dioxide through the combustion of organic matter.

However, the combustion associated with human use of fossil fuels has significantly altered the carbon cycle. Fossil fuel combustion, such as burning coal, oil, and gas, has substantially increased the amount of carbon dioxide released into the atmosphere.

This additional carbon dioxide has led to an increase in atmospheric concentrations, contributing to climate change and disrupting the natural balance of the carbon cycle.

Therefore, while combustion was a component of the carbon cycle before humans used fossil fuels, human activities have greatly intensified their impact on carbon dioxide levels and the global carbon cycle.

For more such answers on fossil fuels

https://brainly.com/question/15603154

#SPJ8

I need help ASAP I need this assessment done by 10:00 and its 9:00
You have explored some informative examples of models. Now it's time to get creative and make your own model. Here is the requirement checklist for your model:

Model types can include drawings, diagrams, physical models, virtual simulations, or videos.
Model must be created by you, not something selected from an online or outside source.
Submit a presentation, picture, video, or screenshot of your model.
Submit a one-paragraph summary describing the topic you chose, your model, what it represents, how you made it, and the specific science involved. It is important that you are using science terminology and are accurate.

there are three topics, I chose cellular respiration but you can do carbon cycle or photosynthesis if either of them is easier

Answers

Answer:

This says 'No online sources' but whatever, I'll help with what I can.

Explanation:

You could do a drawing of the photosynthesis cycle, cause thats what I'm best with. The paragraph is on you.

7. Since the allele for color blindness is located on the X chromosome, color
blindness

1 cannot be inherited

2 occurs only in adults

3 is sex-linked

4 none of the above

(HELP ME PLEASEEE!)

7. Since the allele for color blindness is located on the X chromosome, colorblindness1 cannot be inherited2

Answers

3. Is sex-linked, because chromosomes are identified by numbers but the sex chromosomes are identified by X and Y

Hemophilia A and red-green color blindness are examples of X-linked recessive diseases. Color blindness to red and green. Red-green color blindness prevents a person from recognizing red and green hues (usually blue-green). Otherwise, though, they can see normally. Thus, option C is correct.

What allele for color blindness located on X chromosome?

Females have two X chromosomes, while males have one X and one Y chromosome. The X chromosome is where the genes that might cause red-green color blindness are handed down. Men are more likely than women to have red-green color blindness, since it is X-chromosom-inherited.

One of the most prevalent genetic (inherited) disorders in the world is color blindness, which means it is typically inherited from your parents.

Therefore, the allele for color blindness is located on the X chromosome, color blindness is sex-linked.

Learn more about color blindness here:

https://brainly.com/question/29658462

#SPJ6

If a purine paired with another purine, which feature of DNA would most likely be different?a. The DNA would be a triple helix.b. The nitrogenous bases would no longer be exposed in the major and minor grooves.c. DNA strands would run parallel, not antiparallel.d. The double helix would no longer have a uniform diameter.e. The DNA helix would be left-handed, not right-handed.

Answers

If a purine were to pair with another purine, the feature of DNA that would most likely be different is that the double helix would no longer have a uniform diameter.                                                                                                                          

This is because purines, which include adenine and guanine, are larger than the pyrimidines (cytosine and thymine) that they normally pair with. This results in a wider distance between the two strands of the DNA double helix where purines are paired together. This could potentially cause structural instability in the DNA molecule and impact its function.
Pairing two purines would result in a wider region, disrupting the uniform diameter of the double helix, while still preserving the antiparallel nature of DNA strands, the major and minor grooves, and the right-handed helical structure.

Learn more about DNA here:|
https://brainly.com/question/30006059

#SPJ11

Explain why unreactive metals are good for making jewelry

Answers

Explanation:

Platinum, gold and silver are used to make jewellery because the metals used in jewellery are always be chosen on the basis of its reactivity. It should be unreactive so that the metal does not tarnish. Many metals used for jewellery are expensive as well because they are rare.

enzyme activity can be affected by the following check all that apply

Answers

Answer:

enzyme activity is affected by many factors such as temperature, concentration and ph  note that enzymes work best within a certain ph ranges

Explanation:

What are the characteristics of manganese?

Answers

Answer:

"Manganese is a grey-white, hard and very brittle metal.

It tarnished on exposure to air and oxidized to manganese when heated."

Credits to: Yahoo

Answer:

Manganese is a pinkish-gray, chemically active element. It is a hard metal and is very brittle. It is hard to melt, but easily oxidized. Manganese is reactive when pure, and as a powder it will burn in oxygen, it reacts with water (it rusts like iron) and dissolves in dilute acids.

Explanation:

the genes associated with alcohol use disorder and tobacco dependence appear to produce deficiencies in the brain pathways associated with the neurotransmitter:

Answers

The genes associated with alcohol use disorder and tobacco dependence appear to produce deficiencies in the brain pathways associated with the neurotransmitter dopamine.

Dopamine is a neurotransmitter that plays a crucial role in reward, motivation, and pleasure pathways in the brain. The genes associated with alcohol use disorder and tobacco dependence have been found to influence the functioning of these pathways, leading to deficiencies in dopamine transmission.

Alcohol use disorder and tobacco dependence are complex conditions influenced by both genetic and environmental factors. Studies have identified certain genetic variations that are more common in individuals with these disorders. These genetic variations are involved in the regulation of dopamine receptors, transporters, and other components of the dopamine signaling pathway.

Deficiencies in the dopamine pathways can affect the brain's reward system, leading to altered responses to alcohol and tobacco. Individuals with these genetic variations may experience reduced dopamine release or impaired dopamine receptor function, which can contribute to a heightened susceptibility to alcohol and tobacco addiction.

Understanding the role of dopamine and the genetic factors involved in alcohol use disorder and tobacco dependence is crucial for developing effective prevention and treatment strategies. By targeting the dopamine pathways and related genetic factors, researchers and healthcare professionals aim to address the underlying mechanisms of addiction and develop personalized approaches for individuals struggling with these disorders.

Learn more about neurotransmitter dopamine here:

https://brainly.com/question/31455006

#SPJ11

In general, all croplands tend to reduce the diversity and number of pollinator species. In which areas do croplands lead to the greatest % decline in pollinator species?


1. Near urban areas

2. Near pasture

3. In tropical areas

4. In temperate areas

5. In mountainous areas

Answers

It is possible that near urban areas the diversity and number of pollinator species gets reduced. The correct option is 1.

What are pollinators?

A pollinator is something that assists in the transport of pollen from either the male part of the flower (stamen) to the female part of a similar or another flower (stigma).

Pollen movement is required for the plant to become fertilized and generate fruits, seeds, and young plants.

Loss of habitat is one of the most serious threats to pollinators.

Expanding urbanization and agricultural development consume these creatures' habitat and replace it with roadways, vast swaths of lawn, and exotic garden plants.

Thus, the correct option is 1.

For more details regarding pollination, visit:

https://brainly.com/question/13260796

#SPJ1

Which type of tissue would have the highest mitotic index: muscle, skin, kidney, or lung
Please Explain.

Answers

Answer:

From the following list, which normal tissues would you expect to have the highest mitotic index: muscle, skin, kidney, or lung? Explain your answer. Skin and lung tissue would likely have the highest mitotic index due to the need for higher cell turnover.

What embrylogical stage is characterized by the rearrangement of blastula cells?

Answers

The embryological stage that is characterized by the rearrangement of blastula cells is called gastrulation.

During this stage, the blastula transforms into a gastrula as cells migrate and rearrange themselves to form the three germ layers: endoderm, mesoderm, and ectoderm.

A single-layered blastula embryo becomes a multilayered structure called a gastrula through a process known as gastrulation. The three basic germ layers—ectoderm, mesoderm, and endoderm—are created through a sequence of intricate cell motions and modifications that take place during this process. The mesoderm develops into the muscles, bones, and connective tissues, whereas the ectoderm gives rise to the skin, neurological system, and sensory organs. The digestive and respiratory systems, as well as several internal organs, are all derived from the endoderm. Gastrulation is a crucial stage in the development of the embryo because it lays the groundwork for the production of all the body's major tissues and organs.

Learn more about blastula here:

https://brainly.com/question/29457993

#SPJ11

the best food source of omega-6 fatty acids is fish and seafood. True or False

Answers

The given statement "The best food source of omega-6 fatty acids is fish and seafood" is False because fish and seafood do contain omega-6 fatty acids, but they are not the best food source.

Omega-6 fatty acids are essential fatty acids that are important for maintaining good health. They play a vital role in maintaining healthy skin, regulating blood pressure, and promoting cardiovascular health.

The best food sources of omega-6 fatty acids are vegetable oils such as sunflower, safflower, and corn oil, as well as nuts and seeds such as almonds, pine nuts, and pumpkin seeds. These sources contain a higher concentration of omega-6 fatty acids than fish and seafood.

However, it is important to note that excessive intake of omega-6 fatty acids can lead to inflammation and other health issues. Therefore, it is recommended to maintain a balance between omega-3 and omega-6 fatty acids by consuming a variety of foods such as fatty fish, flaxseed, and chia seeds that are rich in omega-3 fatty acids as well.

You can learn more about omega-6 fatty acids at: brainly.com/question/31068246

#SPJ11

select all the methods used by microbiologists to identify and classify prokaryotes.

Answers

Microbiologists use various methods to identify and classify prokaryotes. Some of the commonly used methods include:

1. Morphological characteristics: This method involves observing the shape, size, and structure of the prokaryotic cells under a microscope.

2. Staining reactions: Staining techniques such as Gram staining, acid-fast staining, and endospore staining can help in the identification of different types of prokaryotes.

3. Biochemical tests: These tests involve analyzing the metabolic activities of prokaryotes, such as their ability to utilize different nutrients and produce enzymes.

4. Serological tests: These tests involve the use of antibodies to identify specific antigens on the surface of prokaryotic cells.

5. DNA sequencing: The analysis of DNA sequences can help to identify and classify prokaryotes based on their genetic makeup.

6. Molecular techniques: Polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), and other molecular techniques can be used to identify and classify prokaryotes based on their DNA.

7. Culture-based methods: These methods involve growing prokaryotic cells in culture media under specific conditions to identify and classify them based on their growth characteristics.

To know more about prokaryotes refer  here

brainly.com/question/29119623#

#SPJ11

Suppose two leaf eating insects live in an area where there is a severe
drought. Many of the plants they both eat die off. What kind of a
relationship do the two insects have? *
*
commensalism
competition
mutualism
predation

Answers

Answer:

competition

Explanation:

they have a competitive relationship because they now need to find new plants to survive on and they must make sure they themselves will live

Which phrase explains what the arrows show? how convection currents move in Earth’s interior the location of heated material near Earth’s surface where plates move as material cools in the outer core why the densities of materials remain constant at different layers.

Answers

The phrase that explains the arrows is how convection currents move in Earth’s interior.

What is convection current?

The convection current is the process of movement of the heat from one place to another.

It is a single or multiphase flow of fluid due to body force and heterogeneity.

The convection current happens when the fluid is heated from the bottom and cooling from the upside.

Thus, the correct option is a, how convection currents move in Earth’s interior.

Learn more about convection current, here

https://brainly.com/question/4138428

Answer:

A

Explanation:

Edge22'

hii i'm having trouble with this bc of my favorite animal!!! PLS HELP T-T

In order to survive, animals need to adapt to their environment over many generations. Think about your favorite animal, its physical features, and its environmental challenges. Without doing any outside research, in 3-5 sentences, try to: a) describe what features have likely had to adapt to its environment over time, and b) hypothesize what ways it might have to adapt to environmental changes in the future.

(my favorite animal is a cow, specifically fluffy cows!)

Answers

Answer:

Cows, like most mammals, have evolved to adapt to their environment over time. For example, their digestive system has adapted to efficiently digest grasses and other plants. The unique feature of fluffy cows is their long hair, which helps them regulate their body temperature in colder environments. In the future, if there are changes in their environment, such as increased heat due to climate change, fluffy cows may need to adapt by developing more effective cooling mechanisms or moving to cooler regions.

BRAINLIEST PLEASE!

which portion of the photosynthetic apparatus absorbs light?

Answers

The light-absorbing portion of the photosynthetic apparatus is known as the antenna complex or light-harvesting complex, which consists of pigment molecules.

In photosynthesis, the process by which plants and some other organisms convert light energy into chemical energy, the light-absorbing portion is crucial for capturing photons and initiating the energy conversion process. This portion is comprised of a complex arrangement of pigments known as the antenna complex or light-harvesting complex. The antenna complex is located in the thylakoid membrane of the chloroplasts in plant cells.

The antenna complex consists of various pigment molecules, including chlorophylls and carotenoids, which are responsible for absorbing different wavelengths of light. These pigments are organized in a highly organized manner to efficiently capture light energy. When light is absorbed by the pigments, it excites the electrons within them, initiating a chain of energy transfer reactions.

The absorbed light energy is then transferred from one pigment molecule to another until it reaches the reaction center, where the actual photochemical reactions of photosynthesis take place. The reaction center contains specialized chlorophyll molecules that can directly convert light energy into chemical energy by initiating the electron transport chain and the production of ATP (adenosine triphosphate) and NADPH (nicotinamide adenine dinucleotide phosphate).

Learn more about light-harvesting complex :

https://brainly.com/question/27699246

#SPJ11

after a meal, both insulin and glucagon are secreted into the blood stream. what is their relationship?

Answers

Together with the hormone insulin, glucagon regulates blood sugar levels and helps to maintain target ranges. Insulin is produced to prevent blood sugar levels from increasing too high (hypoglycemia) while glucagon is released to prevent blood sugar levels from falling too low  (hyperglycemia).

The pancreatic islets of Langerhans' alpha cells release the peptide hormone known as glucagon. The best-known effect of glucagon is to promote glucose synthesis in the liver and hence maintain appropriate plasma glucose concentrations. Hypoglycemia is physiologically the most powerful secretory stimulation. The metabolism of hepatic lipids and amino acids is also influenced by glucagon, which may lead to an increase in resting energy expenditure.

The INS gene in humans encodes insulin, a peptide hormone generated by beta cells of the pancreatic islets. It is regarded as the body's primary anabolic hormone.

To learn more about hypoglycemia click here,

https://brainly.com/question/14757163

#SPJ4

Identify on the DNA sequence below where the complementary binding sites for the Bird 12 S primers are: Bird 12Sa Forward: 5' CTGGGATTAGATACCCCACTAT 3' Bird 12Sh Reverse: 5' CCTTGACCTGTCTTGTTAGC 3' What is the amplicon length? 5 2
TAGGACACAAACTGGGATTAGATACCCCACTATGCCTAGCCCTAAATCTAGATGT100bp−AAAGCCTACCCCGCTAACAAGACAGGTCAAGGTATAGCCCATGAA3 ′

Answers

The complementary binding sites for the Bird 12 S primers in the given DNA sequence are CTGGGATTAGATACCCCACTAT and CCTTGACCTGTCTTGTTAGC. These sites are found in the DNA sequence given below:

TAGGACACAAACTGGGATTAGATACCCCACTATGCCTAGCCCTAAATCTAGATGT100bp−AAAGCCTACCCCGCTAACAAGACAGGTCAAGGTATAGCCCATGAA3 ′

The forward primer binds to the DNA strand in a direction of 5' to 3'. Thus, it binds to the DNA sequence CTGGGATTAGATACCCCACTAT.

The reverse primer binds to the DNA strand in a direction of 3' to 5'. Thus, it binds to the DNA sequence CCTTGACCTGTCTTGTTAGC. Therefore, the complementary binding sites for the Bird 12 S primers in the given DNA sequence are:Forward: 5' CTGGGATTAGATACCCCACTAT 3'Reverse: 5' CCTTGACCTGTCTTGTTAGC 3' The amplicon length is 100 base pairs (bp).

To know  more about DNA sequence here:

brainly.com/question/31650148

#SPJ11

In the word search below are the names of several pieces of lab equipment. As you find each piece of equipment, record its name on the list.
There are only 13 words out of the listBunsen burner,Pipestem triangle, Evaporating dish, Beaker, Utility clamp,Iron ring, Mortar and pestle, Crucible and cover, Gas bottle, Saftey goggles,Corks, Watch glass, Erlenmeyer flask, Wire gauze, Pipet, Buret,Triple beam balance, Test tube rack, Funnel, Scoopula,Well plate, Wire brush,File,Wash bottle, Graduated cylinder,Thanks​

In the word search below are the names of several pieces of lab equipment. As you find each piece of

Answers

Answer:

Bunsen Burner - second last line

Pipestem triangle - third row diagonal

evaporating dish - fifth row diagonal

utility clamp - seventh row

iron ring - second last column

gas bottle - last line

wire gauze- second line

Explanation:

The crosswords are important brain storming exercise which helps to develop the ideas to improve intelligence. The cross words arrangement will help to understand the words and solve basic word puzzle. The arrangements can be make to use a letter from other word which completely form a new word.

As per observation, the word search below are the names of several pieces of lab equipment are given below:

1. Bunsen Burner - 2d remaining line

2. Pipestem triangle- 1/3 row diagonal

3. Evaporating dish- 5th row diagonal

4. beaker -2d row

5. Utility clamp - 7th row 6. Iron Ring - 2d remaining column

7. Mortar and pestle - 5th column

8. Crucible and cover - 10th row diagonal

9. Gas bottle - Last line

10. Safety goggles - Fifth column

11. Corks - besides the phrase thermometer

12. Watch Glass - Seventh column inverted

13. Wire gauze - 2d line

The crosswords are critical mind storming exercising which enables to increase the thoughts to enhance intelligence. The pass phrases association will assist to recognize the phrases and clear up fundamental phrase puzzle. The preparations may be make to apply a letter from different phrase which shape a whole new phrase.

What is lab equipment?

Among the numerous objects that might be taken into consideration, the standard lab system is pipettes, scales, centrifuges, Bunsen burners, freezers, warm plates, incubators, coolers, stirrers, water baths, and fume hoods - to call a few.

Thus it is clear that the above answers are well explained.

To learn more about the lab equipment refer to the link :

https://brainly.com/question/8430576

which era characterized by the extinction of reptiles and the appearance of mammals is considered significant in geological history​

Answers

Answer:

Mesozoic Era

Explanation:

The "Mesozoic Era" is divided into three periods: Triassic, Jurassic and Cretaceous. During the last period (Cretaceous), which was considered the longest, the extinction of reptiles occurred and the new mammals appeared. This event was also known as the "Cretaceous-Paleogene Extinction Event." Around 3/4 of plants and animals died. Such event became significant boundary that laid between the Cenozoic Era and the Mesozoic Era. This made it significant in geologic history.

Other Questions
page 307 9.1. explain how political parties form and change. according to political scientist e. e. schattschneider, in order to represent and mobilize the broadest range of voters, political parties need to have which of the following? A type of electrical tape used to provide a protective overwrap for high-voltage cable is _________________________. A spinal reflex requires the participation of each of the following except:a. cerebral cortexb. sensory neuronc. interneurond. motor neuron Under the Reconstruction Acts of 1867, what was asked of Southern states before rejoining the Union? Which compound inequality is equivalent to for all real numbers a, b, and c, where which of these isnot an environmental force? group of answer choices technological regulatory administrative competitive economic What is Zumbox?A. An online mail system with a digital mailbox for every houseB. An online virus that could threaten social media sitesC. An alternative to Twitter that has the address of every individualD. An innovative network that allows the messages of citizens toreach CongressSUBMIT When administering morphine to a patient with a suspected myocardial infarction, the nurse understands that the medication has which beneficial effects? help worth 50 pointsWhich factor does not determine the strength of a toxin on a human population? Length of exposure Timing of exposure Genetic differences Substance type If 2(x-y)=3y, what is the ratio x/y use the given probability value to determine whether the sample results could easily occur by chance, then form a conclusion. a study addressed the issue of whether pregnant women can correctly predict the gender of their baby. among 104 pregnant women, 57 correctly predicted the gender of their baby. if pregnant women have no such ability, there is a 0.327 probability of getting such sample results by chance. what do you conclude? A scale model of an object is 5 inches tall. The actual object is 250 feet tall. What is the scale factor of the model?The scale factor is ___ : ___ the adi granth begins with a concise summary of sikh theology known as the Which type of respiration is more efficient at producing ATP? how much storage does genshin impact take up on mobile You're given the output of an ls -l of a file in Linux. 123 ls -l books_file dr-x-wxr-- 1 phelan cool_group 0 Aug 20 11:10 books_file Answer the following question: Who does the last trio of bits (r--) in the file permission and attributes refer to Calculate the kinetic energy in N.m of a 15-kg mass if it has a velocity of 1.20 m/s. (The formula for kinetic energy is KE=1/2 mv2 , where m=mass and v=velocity.) 3. How would a Eugenicist define someone who is Defective"? Which abstract data type (ADT) is most suitable to store a list of perishable products such that the product with the nearest expiry date is removed first? O A deque A linked list A queue A priority queue What did chargaff conclude from the observation that in double-stranded dna, adenine is found in the same amount as thymine, and that guanine is found in equal amounts as cytosine?