Which comparison statement describes the model below 6 6 6 6 24

Answers

Answer 1
^^^ Don’t click on that link it’s a scam

Related Questions

) In a geometric progression, the sum of the first two terms is equal to 16. The sum to infinity is equal to 25. Find the possible values of the first term. ​

Answers

There are no possible real values for the first term 'a' that satisfy both equations.

Let's denote the first term of the geometric progression as 'a' and the common ratio as 'r'.

The sum of the first two terms can be expressed as:

a + ar = 16

To find the sum to infinity, we can use the formula:

Sum to infinity = a / (1 - r)

Given that the sum to infinity is 25, we have:

25 = a / (1 - r)

We now have two equations:

a + ar = 16

a / (1 - r) = 25

We can solve these equations simultaneously to find the possible values of 'a'.

From the first equation, we can factor out 'a' to get:

a(1 + r) = 16

Dividing both sides of the second equation by 25, we have:

a / (1 - r) = 1

We can rearrange this equation to get:

a = 1 - r

Substituting this expression for 'a' in the first equation, we get:

(1 - r)(1 + r) = 16

Expanding the equation, we have:

1 - r^2 = 16

Rearranging the terms, we get:

r^2 = -15

Since we are dealing with a geometric progression, the common ratio 'r' must be a real number. However, we observe that r^2 = -15 has no real solutions. Therefore, there are no possible real values for the first term 'a' that satisfy both equations.

for such more question on real value

https://brainly.com/question/27371101

#SPJ8

−3 ⋅(−6)



pls help :)

Answers

Answer:

18

Step-by-step explanation:

If you multiply negative numbers together they will cancel out and become positive. So -3 x (-6) is 18.

mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmoby max pls help

mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmoby max pls help

Answers

Answer:

5/4 or 1 1/4 or 1.25

Step-by-step explanation:

answer quickly pls pls pls

answer quickly pls pls pls

Answers

Third option
divide the exponent by 2
(C)

Please help I will give u points

Please help I will give u points

Answers

The answer to this problem is B

What is the solution to this equation? 6x + 5 = 29 Enter your answer in the box. x =

Answers

X should be 4 , 6*4= 24 +5 =29

Answer:x=4

Step-by-step explanation: I took the K12 test and I got 100%

Find the area of the triangle
in square inches.
height 110 in.
length 1.5 ft

Answers

9514 1404 393

Answer:

  990 square inches

Step-by-step explanation:

The area is the half the product of length and height.

  A = (1/2)(18 in)(110 in) = 990 in²

The area of the triangle is 990 square inches.

write a formula for f(a) in terms of a -3a + 6b = a + 4b

write a formula for f(a) in terms of a -3a + 6b = a + 4b

Answers

Answer:

\(\huge\boxed{\sf f(a) = 2a}\)

Step-by-step explanation:

-3a + 6b = a + 4b

Isolate b

6b - 4b = a + 3a

2b = 4a

b = 4a / 2

b = 2a

Replace b by f(a)

f(a) = 2a

\(\rule[225]{225}{2}\)

Hope this helped!

~AH1807

Answer:

Step-by-step explanation: Answer: 2a

Trust ;)

Find the sum of the following finite geometric series.

Find the sum of the following finite geometric series.

Answers

The sum of the geometric sequence in this problem is given as follows:

5.77.

What is a geometric sequence?

A geometric sequence is a sequence of numbers where each term is obtained by multiplying the previous term by a fixed number, which is called the common ratio q.

The first term, the common ratio and the number of terms for this problem are given as follows:

\(a_1 = 10, q = -\frac{2}{3}, k = 8\)

The formula for the sum of the first n terms is given as follows:

\(S_n = a_1\frac{1 - r^n}{1 - r}\)

Hence the sum for this problem is given as follows:

\(S_8 = 10 \times \frac{1 - \left(-\frac{2}{3}\right)^8}{1 + \frac{2}{3}}\)

\(S_8 = 5.77\)

More can be learned about geometric sequences at brainly.com/question/24643676

#SPJ1

What is the domain of the function y=\sqrt{x}
What is the domain of the function y = StartRoot x EndRoot?

What is the domain of the function y=\sqrt{x}What is the domain of the function y = StartRoot x EndRoot?

Answers

Answer: C (third choice)

Step-by-step explanation:

Square roots cannot hold negative x values as it will create an imaginary number.

Therefore the starting value of x must be starting at 0 and then moving to infinity

Answer:

c

Step-by-step explanation:

f(x) = 4x and g (x) = 4x -3. find the product of ( f . g ) (x)

Answers

Here, I hope it's helpful.

f(x) = 4x and g (x) = 4x -3. find the product of ( f . g ) (x)

Answer:

16x² - 12x

Step-by-step explanation:

(f • g )(x)

= f(x) × g(x)

= 4x(4x - 3) ← multiply each term in the parenthesis by 4x

= 16x² - 12x

Solve the equation
Y=2
then solve
W = -3 -2y

Answers

Answer:

w= -3-2*2 = -7

Step-by-step explanation:

make it braintliest please

Two trains leave the station at the same time, one heading west and the other east. The westbound train travels 10 miles per hour slower than the eastbound train. If the two trains are 400 miles apart after 2 hours, what is the rate of the westbound train?

Answers

Answer:

the rate of the westbound train is 95 miles per hour.

Step-by-step explanation:

Let's denote the rate of the eastbound train as "x" miles per hour. Since the westbound train travels 10 miles per hour slower, its rate can be represented as "x - 10" miles per hour.We know that the total distance covered by both trains after 2 hours is 400 miles.The eastbound train covers a distance of 2x miles in 2 hours.

The westbound train covers a distance of 2(x - 10) miles in 2 hours.Since the total distance covered is 400 miles, we can set up the equation:2x + 2(x - 10) = 400Simplifying the equation:2x + 2x - 20 = 400

4x - 20 = 400

4x = 420

x = 105

Therefore, the rate of the eastbound train is 105 miles per hour.To find the rate of the westbound train, we substitute this value back into the expression "x - 10":Rate of the westbound train = 105 - 10 = 95 miles per hour.Hence, the rate of the westbound train is 95 miles per hour.

After working satisfactorily for 6 months, Collin will be eligible for a 7% raise. How much will Collin's
gross salary be, after her raise, for each 2-week pay period? His current gross salary is $1,083.34.

Answers

Collin's gross salary, after the 7% raise, for each 2-week pay period, will be approximately $1,159.17.

To calculate Collin's gross salary after the 7% raise for each 2-week pay period, we need to find the raise amount and add it to his current gross salary.

Collin's current gross salary is $1,083.34.

To find the raise amount, we multiply his current gross salary by 7% (or 0.07):

Raise amount = $1,083.34 \(\times\) 0.07

= $75.8338 (rounded to two decimal places)

Now, we add the raise amount to his current gross salary to find the new gross salary:

New gross salary = $1,083.34 + $75.8338 = $1,159.1738 (rounded to two decimal places)

For similar question on gross salary.

https://brainly.com/question/28905653  

#SPJ8

Use synthetic division to solve (x3 + 1) = (x - 1). What is the quotient?

x² + x + 1 + 1 2 3
x2-x+1
x2+x+1+2
x3 - x2 + x

Answers

Synthetic division yields

1   |   1   0   0   1

.   |        1    1    1  

= = = = = = = = = =

.   |   1    1    1    2

which translates to

(x³ + 1) / (x - 1) = x² + x + 1 + 2/(x - 1)

where the quotient is x² + x + 1.

What is the number of significant figures in 122.35 cm ?

Answers

Answer:

5

Step-by-step explanation:

fill in the mission numbers to make the fractions equivalent. 1/2 and /8= 4/12 and /60= 2/3 and /12= 4/4 and /8=​

Answers

To make the fractions equivalent, we need to find the missing numerators that would make them equal. Let's fill in the missing numerators:

1/2 and __/8

To make the fractions equivalent, we can multiply both the numerator and denominator of the first fraction by 4:

1/2 and 4/8

Now, the fractions are equivalent.

---

4/12 and __/60

To make the fractions equivalent, we can multiply both the numerator and denominator of the first fraction by 5:

4/12 and 20/60

Now, the fractions are equivalent.

---

2/3 and __/12

To make the fractions equivalent, we can multiply both the numerator and denominator of the first fraction by 4:

2/3 and 8/12

Now, the fractions are equivalent.

---

4/4 and __/8

To make the fractions equivalent, we can multiply both the numerator and denominator of the first fraction by 2:

4/4 and 8/8

Now, the fractions are equivalent.

Use the range rule of thumb to identify the values that are significantly​ low, the values that are signficantly​ high, and the values that are neither significantly low nor significantly high.
A test is used to assess readiness for college. In a recent​ year, the mean test score was 21.2 and the standard deviation was 4.9 . Identify the test scores that are significantly low or significantly high.

Answers

The Significantly low test score is 12.1 and significantly high score value is 31.7.

What is z-score?

The standard score is the number of standard deviations by which the value of a raw score is above or below the mean value of what is being observed or measured.

Here,  we are dealing with z scores, then the distribution is a normal distribution. The formula for determining the z score is expressed as

                                       z = (x - µ)/σ

Where, x = sample mean,  µ = population mean  σ = standard deviation

From the information given,

µ = 21.9

σ = 4.9

For significantly low values, z = - 2

Therefore,

- 2 = (x - 21.9)/4.9

- 2 × 4.9 = x - 21.9

- 9.8 = x - 21.9

x = - 9.8 + 21.9

x = 12.1

Significantly low test score = 12.1

For significantly high values, z = 2

Therefore,

2 = (x - 21.9)/4.9

2 × 4.9 = x - 21.9

9.8 = x - 21.9

x = 9.8 + 21.9

x = 31.7

Thus, the Significantly low test score is 12.1 and significantly high score value is 31.7.

Learn more about z-score from:

https://brainly.com/question/15016913

#SPJ1

What is the equation of a circle with center (4, 4) and radius 7?

Answers

Answer:

(x-4)^2 + (y-4)^2 = 49

Step-by-step explanation:

The equation of a circle is given by

(x-h)^2 + (y-k)^2 = r^2  where ( h,k) is the center and r is the radius

(x-4)^2 + (y-4)^2 = 7^2

(x-4)^2 + (y-4)^2 = 49

1.
I Which number line shows the solution to the inequality
-3x - 5 < -2?
A.
B.
C.
D.
-3 -2 -1 0 1
-3 -2 -1 0 1
0++
0 1
3 -2 -1 0
2 3
2 3
2 3
+++
-3 -2 -1 0 1 2 3

Answers

The number line that shows the solution to the inequality -3x - 5 < -2 is A.

Solve 12x- 6y = 18 for y.

Answers

12x - 6y = 18
Subtract 12x
-6y = -12x + 18
Divide by -6
Y = 2x - 3

The given equation solved for y as y=2x-3.

What is an equation?

In mathematics, an equation is a formula that expresses the equality of two expressions, by connecting them with the equals sign =.

The given equation is 12x-6y=18.

The solution of an equation is the set of all values that, when substituted for unknowns, make an equation true.

The equation can be solved as follows

6(2x-y)=18

⇒ 2x-y=3

⇒ y=2x-3

Therefore, the given equation solved for y as y=2x-3.

To learn more about an equation visit:

https://brainly.com/question/14686792.

#SPJ2

Solve me this please
X=33500+0,2Y
Y=26500+0,1X

Answers

Answer: X= 108125 and  Y  = 373125.

Step-by-step explanation:

Given system :

\(X= 33500+0.2Y (i)\\\\ Y=26500+0.1X (ii)\)

Consider (ii)

\(Y=26500+0.1X\\\\\Rightarrow\ Y-0.1X=26500\)

Multiply 10 on both sides , we get

\(10Y-X=265000 (iii)\)

Add (i) and (iii)

\(10Y= 33500+26500+0.2Y\\\\\Rightarrow\ 10Y-0.2Y= 298500\\\\\Rightarrow\ 0.8Y= 298500\\\\\Rightarrrow\ Y=\dfrac{298500}{0.8}\\\\\Rightarrrow\ Y=373125\)

Put this in (i)

\(X= 33500+0.2(373125) =108125\)

Hence, X= 108125 and  Y  = 373125.

1
Combine like terms:
1. 10t2 - 18 + 14 - 2t - t2 - 5 + 7t
2. 18d2 - 13d - 17 -2d

1Combine like terms:1. 10t2 - 18 + 14 - 2t - t2 - 5 + 7t2. 18d2 - 13d - 17 -2d

Answers

Answer:1) 9t^2 + 5t − 9 2) 18d^2 − 15d − 17_____________________________________Hope this helped!Also, I need everyone to know something! Don't let anyone ever push you down or call you worthless.  You are worth everything and more! So stay strong, hold on, and live long!  Most people don't hear this often. Your all loved, no matter what it feels like. So please, stay strong. If not for yourself then for me and everyone else who cares for you...Love you all, beauties!~ <3░░░░░░░░░░░▄▀▄▀▀▀▀▄▀▄░░░░░░░░░░░░░░░░░░ ░░░░░░░░░░░█░░░░░░░░▀▄░░░░░░▄░░░░░░░░░░ ░░░░░░░░░░█░░▀░░▀░░░░░▀▄▄░░█░█░░░░░░░░░ ░░░░░░░░░░█░▄░█▀░▄░░░░░░░▀▀░░█░░░░░░░░░ ░░░░░░░░░░█░░▀▀▀▀░░░░░░░░░░░░█░░░░░░░░░ ░░░░░░░░░░█░░░░░░░░░░░░░░░░░░█░░░░░░░░░ ░░░░░░░░░░█░░░░░░░░░░░░░░░░░░█░░░░░░░░░ ░░░░░░░░░░░█░░▄▄░░▄▄▄▄░░▄▄░░█░░░░░░░░░░ ░░░░░░░░░░░█░▄▀█░▄▀░░█░▄▀█░▄▀░░░░░░░░░░ ░░░░░░░░░░░░▀░░░▀░░░░░▀░░░▀░░░░░░░░░░░░

Sorry I dunno! :V

jt dnhnnfghggf poinTstss

Need help ASAP thankyou!!!!

Need help ASAP thankyou!!!!

Answers

Answer:

V =100.48 cm^3

Step-by-step explanation:

The volume of a cone is given by

V = 1/3 pi r^2 h

V = 1/3 pi ( 4)^2 6

V = 1/3 pi ( 16)*6

V =32 pi cm^3

Let pi 3.14

V =100.48 cm^3

Answer:

Volume = \(100.48 \,\,cm^3\)

Step-by-step explanation:

Recall that the volume of the cone is given by the formula:

\(Volume=\frac{1}{3} Base * Height\)

that is, one third of the product of the triangles base area times the triangle's height. In this case, the area of the base is a circle of radius 4 cm which using the formula for the area of the circle gives:

\(\pi\,R^2=\pi\,(4\,\.cm)^2=16\,\pi\,\,cm^2\)

using this expression for the base in the volume formula, as well as the height of the cone (6 cm) it renders:

\(Volume=\frac{1}{3} \,16\,\pi\,(6)\,\,cm^3=32\,\pi\,\, cm^3=100.48 \,\,cm^3\)

Patti went to the bakery. She bought a loaf of bread for $3.49, 6 muffins that cost $1.25 each, and a bottle of juice for $1.79. She gave the cashier a $20 bill.

Btw..i need the equation to.

Answers

Answer:

7.22

Step-by-step explanation:

3.49+7.50+1.79= 12.78

20.00 -12.78=7.22

Place the following numbers in order from least to greatest -4.5, -3 5/6, square root of 16, -8/3, -2 pie​

Answers

Answer: -2 pi, -4.5, -3 5/6, -8/3, square root of 16

Step-by-step explanation:

The number which would be the smallest would be the largest negative number sense its farthest from 0 and the greatest would by the biggest positive number in this case being square root of 16.

square root of 16 is 4 sense (4 times 4 is 16)

-8/3= -2.67

-2 pi= -6.28

-3 5/6= -3.834

Abby owns a square plot of land. She knows that the area of the plot is between 2200 and 2400 square meters. Which of the following is a possible value for the side length of the plot of land.

Answers

The possible value of the side length of the plot of land that Abby owns, which is between 2200 and 2400 square meters is A. 48 meters.

What is the length?

The length is the quantitative measurement of a distance from one point to another position.

Length can also refer to the size of an object that has width or/and height.

Data and Calculations:

The square of 2,200m² = 46.9 meters (√2,200)

The square of 2,400m² = 48.99 meters (√2,400)

The square of the median value of 2,200m² and 2,400m², which is 2,300m² is 48 meters approximateluy.

Thus, the possible value of the side length of the plot of land is A. 48 meters.

Learn more about calculating possible side lengths at https://brainly.com/question/17139119

#SPJ1

Question Completion with Answer Options:

A. 48 meters

B. 46 meters

C. 44 meters

D. 50 meters

The Environmental Protection Agency must visit nine factories for complaints of air pollution. In how many ways can a representative visit five of these to investigate this week? Since the representative's travel to visit the factories includes air travel, rental cars, etc., then the order of the visits will make a difference to the travel costs.

Answers

Answer:

The number of ways is  \(\left 9}\atop } \right. P _5 = 15120\)

Step-by-step explanation:

From the question we are told that

   The number of factories visited is  \(n = 9\)

    The number of factories to be visited by a representative  r = 5

The number of way to visit the 5 factories is mathematically represented as

         \(\left 9}\atop } \right. P _5 = \frac{9!}{(9-5)!}\)

Where P represents  permutation

  =>   \(\left 9}\atop } \right. P _5 = \frac{9 \ !}{4\ !}\)

 =>     \(\left 9}\atop } \right. P _5 = \frac{9 *8*7 * 6 * 5 * 4!}{4\ !}\)

=>    \(\left 9}\atop } \right. P _5 = 15120\)

i am trying to figure out what x equals, this is a tangent

i am trying to figure out what x equals, this is a tangent

Answers

Answer:

Good luck mate with that

Step-by-step explanation:

Find the 11th term of the geometric sequence 10, 20, 40, ...

Answers

Answer:

10240

Step-by-step explanation:

Other Questions
a client experienced prolonged labor with prolonged premature rupture of membranes. the nurse would be alert for which condition in the mother and the newborn? module 4.6 connective tissue starting with a short run and long run equilibrium, assume a war breaks out, then," PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA*Remember to begin with the Start Codon "AUG" a sublease will be held to be valid if the landlord accepts rent over a period of time from a subtenant. Why does DNA need to be extracted from a cell before it can be analyzed? . The nucleus contains protons and neutrons and the outer part of the atom contains 8. Value Hardware sells 3-in. finishing nails for 0.99/lb and 2-in finishing nails sell for $1.39/1b. Toni needs 5 lb of nails. If his bill totals $6.15, how many pounds of each size did he buy? Please help me with this. 100 points. What is 8358 x 92849? PLS answer my other questions that I posted. Leah buys 32 strips of ribbon. Each strip is 11.2 inches. Estimate the total length of ribbon that Leah buys. Which transition word or phrase would be most effective in these sentences? I am not able to go to the concert with you. ____________ thank you for asking me. 1) reluctantly 2) ultimately 3) nevertheless 4) moreover Which is a TRUE statement about the energy pyramid shown? The length and the breadth of a rectangle are 40 m and 30 m respectively. If its perimeter = perimeter of a square. Find the side of the square There is a connection between changes in ________ with various mood and anxiety disorders. If a restaurant has two groups of customers, seniors and nonseniors, the nonseniors will be offered aA. lower price because they have a more elastic demand and the firm's profits will increase from sales to both groups.B. higher price because they have a less elastic demand and the firm's profits will increase from sales to this group.C. higher price because they have a more elastic demand and the firm's profits will increase from sales to this group.D. lower price because they have a less elastic demand and the firm's profits will increase from sales to both groups. Describe the difference between sociology and psychology. Two sides and an angle are given below. Determine whether the given information results in one triangle, two triangles, or no triangle at all. Solve any resulting triangle(s). b = 8, c=5, B = 170 Select the correct choice below and, if necessary, ful in the answer boxes to complete your choice Type an integer or decimal rounded to two decimal places as needed.)A. A single triangle is produced, where C = ___, A =___ and a =___B. Two triangles are produced, where the triangle with the smaller angle Chas C1 =___ A1 =___ , and a1=___ and the triangle with the larger angle C has C2 =___ A2C. No triangles are produced. A pair of Beats Wireless Headphones normally cost $299.99. They are on sale for $229.99. Find the percent of markdown. What does a negative net worth indicate?a Your assets exceed your liabilities.b. Your assets equal your liabilities.C Your liabilities exceed your assets.d. You have only assets and no liabilities.Please select the best answer from the choices provided