Which of the following best describes how a biotic factor can limit the population growth in a species?

A) A sudden drop in temperature causes nearly half of the species' population to die.

B) Disease leads to a decline in the reproductive rate of the species' main predator.

C) Lack of rainfall over a long period of time forces the species to migrate to a new location.

Answers

Answer 1

Answer: B) Disease leads to a decline in the reproductive rate of the species' main predator.

Explanation: Disease is a biotic factor and A and C are not :)

Answer 2

Answer:

B

Explanation:

B) Disease leads to a decline in the reproductive rate of the species' main predator.


Related Questions

Write an original paragraph of at least 5 sentences in your own words describing where the mass of the tree comes from. WILL GIVE BRAINLIEST

Answers

Answer:

The mass of a tree is primarily carbon. The carbon comes from carbon dioxide used during photosynthesis. During photosynthesis, plants convert the sun's energy into chemical energy which is captured within the bonds of carbon molecules built from atmospheric carbon dioxide and water.

Explanation:

The human body produces 60 billion (60,000,000,000) new cells per day. How many cells does it produce in one hour?

Answers

Answer:

E.g. E. coli—20 min, so in an hour 1 cell would turn into 8.

Given that 60 billion cells are produced in a day in the human body, the number of cells that will be produced in an hour can be calculated by dividing the number of cells by the number of hours in a day. There would be approximately 2.5 billion cells produced in one hour.

How frequently are the cells in our body renewed?

The human body regularly replaces its own cells. Every day, roughly 330 billion cells, or 1% of all our cells are replaced. The equivalent of a new you will have been replenished in 80 to 100 days with 30 trillion.

Each second approximately one million cells of the body die which means 1.2 kg of the cells are destroyed each day. All the cells in the body have a definite lifespan after which they are replenished.

The dead cells of the body are engulfed in a process called phagocytosis and are transferred to the lysosomes where they are degraded.

To learn more about the cells, refer to the link:

https://brainly.com/question/12129097

#SPJ2

2
Select the correct answer.
Respiration is a process where many chemical bonds inside the body break and release energy. This energy is used to perform various activities such
as moving muscles. Explain the energy transformation in this process.
O
A.
Chemical energy from broken bonds is transformed into mechanical energy for muscles.
B. Mechanical energy from broken bonds is transformed into chemical energy for muscles.
C. Mechanical energy from broken bonds is transformed into electrical energy for muscles.
D. Heat energy from broken bonds is transformed into electrical energy for muscles.
Reset
Next

Answers

Respiration is a process where many chemical bonds inside the body break and release energy. This energy is used to perform various activities such as moving muscles. The energy transformation in this process option A.Chemical energy from broken bonds is transformed into mechanical energy for muscles.

Respiration is a complex metabolic process that occurs within living cells and involves the breakdown of glucose and other molecules to produce ATP. ATP is the primary energy currency of the cell, and it is used to power various cellular processes, including muscle contraction.

During respiration, the chemical bonds between the atoms in glucose and other molecules are broken down through a series of enzymatic reactions. These reactions release energy in the form of ATP. ATP is a high-energy molecule that can be used to fuel a variety of cellular processes, including muscle movement.

The energy transformation that occurs during respiration involves the conversion of chemical energy into mechanical energy. The chemical energy stored in the bonds of glucose and other molecules is released during the breakdown process and is used to generate ATP.

In summary, respiration involves the breakdown of chemical bonds in glucose and other molecules to produce ATP, which is used to power various cellular processes, including muscle contraction. The energy transformation that occurs during respiration involves the conversion of chemical energy into mechanical energy. The correct answer is option A.

Know more about  Respiration   here:

https://brainly.com/question/22673336

#SPJ11

explain how precipitation affects the phosphorus cycle

explain how precipitation affects the phosphorus cycle

Answers

Answer:

Disrupts the nitrogen cycle by contaminating the groundwater and making it more difficult for the plants to absorb the nitrogen and causes the phosphorus cycle to accelerate, resulting in an excess of phosphorus in water and soil.

Explanation:

The precipitation affects the phosphorus cycle in many ways where the soil erosion will take place if the precipitation happens then the weathering of rocks along with the soil getting off will make the nutrients loss in the soil.

What is the cycle of rain called as ?

The cycle of the rain is  called as water cycle where the evaporation along with the condensation takes place.

If the precipitation level in the atmosphere is increased then in this case it will increase the transportation of phosphorus along with the other nutrients into soil along with the water sources and the coastal areas as well.

The main reasons of such scenario is because of the deforestation, loss of habitat by the continued invasion of human activities in the natural resources. The reduction of nutrients loss in  soil makes an huge impact over the  phosphorus cycle.

Learn more about phosphorus cycle at :

https://brainly.com/question/15020567

#SPJ2

Which statement about the genetic code is false?
A. There is no punctuation or spacing between codons.
B. Codons are composed of sets of three nucleotides.
C. Every amino acid is specified by a single codon.
D. The genetic code is almost universal, but not quite.

Answers

————C————

Step by step explaintion:
trust me i’m right lol

The statement 'every amino acid is specified by a single codon' about the genetic code is FALSE (Option C).

The genetic code refers to the process by which the heritable information is passed from the DNA sequence to RNA during transcription, and then from RNA to protein during translation.

The genetic code is said to be redundant because there are amino acids that can be encoded by more than one codon.

For example, the amino acid leucine can be specified by four different codons (CUU, CUC, CUA, and CUG).

In conclusion, the statement 'every amino acid is specified by a single codon' about the genetic code is FALSE (Option C).

Learn more in:

https://brainly.com/question/11752138

the initial exposure to an allergen usually does not produce any symptoms. The symptoms usually appear in the second exposure. What events are occurring during this second exposure? In your description include the role of IgE, basophils, mast cells, and the allergen.

Answers

An allergic reaction develops after the second exposure to an allergen as a result of a chain of events.

What is the name of the initial allergy exposure?

Although the first exposure does not result in symptoms, it may render people susceptible to the allergen (a process known as sensitization).

What occurs if a person is exposed to the same allergen twice?

More severe responses could result from repeated exposures. After someone has been exposed to an allergen or experienced an allergic reaction (becomes sensitised), even a very brief exposure to an allergen might result in a severe reaction.

To know more about allergen visit:-

https://brainly.com/question/29388163

#SPJ1

Complete the statement below.
The respiratory system is divided into...
A. the major and minor respiratory systems.
B. the right and left respiratory systems.
C. the relevant and irrelevant respiratory systems.
D. the upper and lower respiratory systems.

Answers

Answer:

D. the Upper and Lower Respiratory Systems

Explanation:

Upper is the nose, sinuses, etc.

Lower is the lungs, bronchial, etc.

ORGANISM A single, self-contained, living thing

Answers

True
Hope this helps?

Is a 8.1 pound bass good for a first bass? My friend caught one off the dock.​

Answers

Answer:

OFC It is! My first bass was only 2 lb.

Explanation:

When energy is transferred to or from a substance, it can change the molecules’ freedom of movement. True or False?

Answers

Answer:

True

Explanation:

When transfer energy, the substance's temperature changes which can change the molecules' freedom. For example, when water freezes the water molecules loose temperature and slow down, unlike in a gas where molecules are free and energetic.

The image below is an example of a food web because


A. Arrows are pointing all over the place.

B. There is more than one path of energy flowing from producers to consumers.

C. Producers are eating consumers.

D. There is only one path for the flow of energy from consumer to producer.

The image below is an example of a food web becauseA. Arrows are pointing all over the place.B. There

Answers

Answer:

B There is more than one path of energy flowing from the producer to consumers

Lab: Absorption and Radiation by Land and Water Lab: Directions
Now that the lab is complete, it is time to write your lab report. The purpose of this guide is to help you write a clear and concise report that summarizes the lab you have just completed.
The lab report is composed of three sections:
Section I: Experimental Overview
Provide background information.
Include the hypothesis.
Summarize the procedure.

Section II: Data and Analysis
Include graphs to display trends in the data.
Identify trends in the data.

Section III: Conclusions
Identify if the hypothesis was supported or refuted.
Provide logical reasoning based on data.
Explain how the experiment could be improved.

To help you write your lab report, you will first answer the eight questions listed below based on the experiment that you have just completed. Then you will use the answers to these questions to write the lab report that you will turn in to your teacher.
You can upload your completed report with the upload tool in formats such as OpenOffice.org, Microsoft Word, or PDF. Alternatively, your teacher may ask you to turn in a paper copy of your report or use a web-based writing tool.

Answers

The lab report gives a description of the purpose, the hypothesis, the procedure, the results, and the conclusion from the experiment performed in the lab.

What is the procedure of writing the lab report on Absorption and Radiation by Land and Water Lab?

The procedure of writing the lab report on Absorption and Radiation by Land and Water Lab is as follows:

Section I: Experimental Overview

Background information:

The absorption and radiation of heat by land and water play a crucial role in understanding the Earth's climate system. Land and water absorb and release heat differently, affecting weather patterns and temperature variations on a global scale.

Hypothesis:

Water will absorb and radiate heat more effectively than land.

Procedure:

Fill two identical containers, one with water and the other with dry soil.

Place a thermometer in each container and record the initial temperature.

Place the containers under a heat lamp for 10 minutes.

Record the temperature of each container every minute for 10 minutes.

Calculate the rate of temperature change for each container.

Section II: Results

The results of the experiment support the hypothesis that water absorbs and radiates heat more effectively than land. The water container had a more rapid temperature increase and decrease than the soil container. This indicates that water absorbs heat more efficiently and releases it more quickly than land.

Section III: Conclusions

The hypothesis was supported by the experimental results. The logical reasoning behind this is that water has a higher heat capacity than land, which means it can absorb and store more heat energy. Additionally, water has a higher thermal conductivity, which means it can transfer heat more efficiently. Therefore, when exposed to a heat source like a heat lamp, water absorbs more heat and releases it more rapidly than land.

To improve the experiment, the containers could be larger to increase the volume of water and soil, and more trials could be conducted to ensure the accuracy of the results.

Learn more about lab report at: https://brainly.com/question/29500102

#SPJ1

What is the mRNA sequence that would be made from the following DNA template sequence as a result of transcription?
AGGCATTGGCAATCATGTCAT

Answers

The mRNA sequence resulting from the given DNA template sequence AGGCATTGGCAATCATGTCAT is UCCGUAACCGUUAGUACAGUA.

To decide the mRNA grouping coming about because of record, we want to supplant the DNA bases with their comparing RNA bases. In DNA, adenine (A) matches with thymine (T), while cytosine (C) matches with guanine (G). In any case, in RNA, uracil (U) replaces thymine.

The given DNA layout arrangement is AGGCATTGGCAATCATGTCAT. To decipher this into mRNA, we supplant every DNA base as follows: A becomes U, G stays as G, C becomes G, and T turns into A. In this way, the relating mRNA grouping is UCCGUAACCGUUAGUACAGUA.

In rundown, the mRNA grouping coming about because of the given DNA layout arrangement is UCCGUAACCGUUAGUACAGUA.

To learn more about mRNA sequence, refer:

https://brainly.com/question/1129567

#SPJ1

what is the difference between cork formation and gum formation in the plants as an immune mechanism​

Answers

Answer:

Cork formation is a type of secondary growth that occurs in the stems and roots of woody plants. Gum formation, on the other hand, is a type of defense mechanism that occurs in response to injury or infection.

Explanation:

Scenario: What 2 systems are working together? Horned lizards have a defense mechanism that includes shooting blood from their eyes. The major veins surrounding the eye of the lizard are controlled by muscles. When the lizard contracts these muscles, blood flow is increased to the head. As a result, a specialized membrane similar to an eyelid fills with blood. Muscles in the eyelid and eye contract to shoot blood when predators approach. Scientists believe the blood deters predators.​

Answers

The two systems that are working together in this scenario are the circulatory system and the muscular system. The circulatory system, which includes the heart, blood vessels, and blood, is responsible for transporting oxygen and nutrients throughout the body. In the case of the horned lizard, the circulatory system is involved in supplying blood to the area around its eyes.

The muscular system is responsible for the movement of the body and the maintenance of posture. In the case of the horned lizard, the muscular system controls the major veins surrounding the eye and is responsible for contracting the muscles to increase blood flow to the head. The muscles in the eyelid and eye also contract to shoot blood when predators approach.

Learn more about the muscular system here.

https://brainly.com/question/3162365

#SPJ1

when did human activity affect a few species and cause them to trophic cascade

Answers

Human activity has caused trophic cascades in several species, with one notable example being the reintroduction of gray wolves to Yellowstone National Park in 1995.

Prior to their reintroduction, the park's ecosystem had suffered due to the absence of wolves, as their absence had allowed the elk population to grow unchecked, resulting in overgrazing of vegetation and a decline in biodiversity.

Once the wolves were reintroduced, they began to prey on the elk, which reduced the elk population and allowed vegetation to recover. As a result, the habitat of other species, such as beavers, songbirds, and even fish, improved, as they were able to utilize the newly regenerated vegetation.

This is a classic example of a trophic cascade, where the removal or addition of one species can have a cascading effect on the rest of the ecosystem.

Human activities such as hunting, deforestation, and pollution have disrupted many ecosystems, causing trophic cascades that can have far-reaching consequences for biodiversity and ecosystem functioning.

Learn more about biodiversity here:

https://brainly.com/question/13073382

#SPJ1

The complete question is:

When did human activity affect a few species and cause them to trophic cascade?

A parachute uses __ to slow down.

A. Gravity
B. Air Resistance
C. Tension

Answers

I’m pretty sure it’s air resistance:)

Answer:

B. Air Resistance

Explanation:

PLEASE ANSWER ASAP FOR BRIANLEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Text:
What is selective breeding?
Long before scientists had technology to manipulate genes, people used selective breeding to manipulate mating. Selective breeding, also called artificial selection, is the process by which humans artificially select plants or animals that are going to breed and flourish according to what we want from them. The process of selective breeding starts with selecting the animals or plants that have the best characteristics. Then force them to breed with one another. Later, select the best of the offspring and combine them with the best you already have and breed again. The process then continues over several generations to develop the desired traits.
What are the benefits to selective breeding?
Selective breeding is an extremely helpful technique that has been used for hundreds of years. In terms of farming, we use this process to develop the best features: maximum yield (or the most possible product), good health and disease resistance. This is done with cows to make more and better tasting milk. We have increased the number of eggs and the size of eggs each hen can produce. In terms of plants, we have selectively bred wheat to be resistant to disease.
This has also helped people who race horses. They are able to combine the fastest, strongest, or highest jumping horse to have the best chance of winning. Humans have also worked to make cats that are hypoallergenic (meaning they don’t cause allergic reactions. They wed out cats that cause allergies and breed cats that produce the smallest reactions.
Breeders use this to make sure that pedigree dogs remain pure bred. This is done purely for physical appearance to ensure wins at dog shows. They have a similar process to create exotic animals like ligers. They cross 2 different species: a tiger and a lion to create this hybrid, or combination of two organisms.

What are disadvantages to selective breeding?
All of the advantages for selective breeding are for humans. Because of this, there are many disadvantages for the animals. In all cases, the gene pool, the number of possible alleles, is reduced. This is because the species are getting the same “best” genes all the time. This is bad because if a new disease appears, all of the species can be wiped out. In general, there is a large amount of variation in a species that gives some resistance to a disease. However, with selective breeding, they are very closely related to one another. So, if one is affected, they probably all will be. Hybrids that humans make are generally sterile, meaning they cannot produce offspring. Purebred dogs can also have very bad health problems because of their small gene pool.

PLEASE ANSWER ASAP FOR BRIANLEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Text:What is selective breeding?Long

Answers

It’s b I took the test on edge

draw the basic monomer (a nucleotide) of both DNA and RNA and label the three parts (phosphate group, pentose sugar & a nitrogen containing base.

Answers

The parts of a nucleotide are the phosphate group, pentose sugar, and a nitrogenous base. The pentose is a ribose molecule in the case of RNA and deoxyribose in the case of DNA. The only difference between ribose and deoxyribose is that ribose at carbon 2' has an OH group while deoxyribose has an H group. Regarding the phosphate groups, no matter if we are talking about DNA or RNA, both have 1 phosphate groups distributed as shown in the image. And finally, the nitrogenous base gives the name to the nucleotide and therefore varies depending on the nucleotide. The nitrogenous bases are adenine, guanine, cytosine, and thymine in the case of DNA, and adenine, guanine, cytosine, and uracil in the case of RNA.

draw the basic monomer (a nucleotide) of both DNA and RNA and label the three parts (phosphate group,
draw the basic monomer (a nucleotide) of both DNA and RNA and label the three parts (phosphate group,

Select the best answer for the question.
16. Identify the appropriate mixed number for the picture shown.
O A. 1 1/4
O B.1/4
O C.4/5
O D.5/4

Select the best answer for the question.16. Identify the appropriate mixed number for the picture shown.O

Answers

The mixed number for the given picture is 1 1/4, the correct option is A.

What are mixed numbers?

A mixed number is one that manages to combine a whole number and an appropriate fraction.

To transform mixed numbers to improper fractions, follow these three steps: Multiply the numerator by the whole number.

Step 1 is to the numerator, add the answer from. Step 2 is adding the numerator to the product got from step 1.Step 3 is writing the improper fraction with the sum got from step 2 in the numerator/denominator form.

In the given picture, there is one box completely filled and one forth portion in second block is filled, so it is representing mixed number i.e., 1 1/4.

Thus, the correct option is A.

For more details regarding mixed numbers, visit:

https://brainly.com/question/24137171

#SPJ1

Question 8(Multiple Choice Worth 3 points)
(04.01 MC)

Starting with the European settlers, humans have introduced earthworms from Europe and Asia into North American forests. These introductions continue through the transport of soil that contains non-native earthworms, such as during construction and through the release of non-native earthworms used for fishing. The effects of non-native earthworms are especially large in forests that did not have any native earthworms. For example, forests of the Great Lakes region did not previously have earthworms until humans introduced them. When non-native earthworms are introduced, the thick layer of leaves, known as leaf litter, covering the ground disappears quickly, thereby altering biogeochemical cycles.

What is a possible negative consequence of introducing the non-native earthworms to forests in the Great Lake regions?
PLease hurry
The earthworms reduce the resources available to other animals that eat dead plant matter.
The earthworm decreases the energy flow from one tropic level to the next.
The earthworms provide an additional food source for primary consumers.
The earthworms burrow, which reduces the nutrients, flow of air, and water underground.

Answers

Answer:

The earthworms reduce the resources available to other animals that eat dead plant matter.

Explanation:

The introduction of non-native earthworms in the Great Lakes region can have negative consequences on the ecosystem, including reducing the leaf litter and other organic matter in the soil, which is a main food resource for many species of animals and invertebrates, causing a decline in the population of those species. I apologize for any confusion my previous response may have caused.

help please i beg i don’t know

help please i beg i dont know

Answers

Answer:B, D

Explanation:

When the roller coaster starts flying down the hill, it gains kinetic energy and loses potential energy.

Can someone help with this ? Thank you if you can actually help

Can someone help with this ? Thank you if you can actually help

Answers

Answer:

a

Explanation:

explain how incomplete dominance differs from co-dominance

Answers

Answer:

Incomplete dominance is when the phenotypes of the two parents blend together to create a new phenotype for their offspring.

An example is a white flower and a red flower producing pink flowers. Codominance is when the two parent phenotypes are expressed together in the offspring

Explanation:

good luck

Hey I really need help on these genetics problems all of them

Hey I really need help on these genetics problems all of them

Answers

To determine the genotypes of the guinea pig parents, we can perform a Punnett square analysis. Let "S" represent the dominant short hair allele and "s" represent the recessive long hair allele.

What is the genotypes  about?

Since the offspring included both short and long-haired guinea pigs, we can infer that both parents were heterozygous for the short hair trait (Ss). The Punnett square for the cross would be:

       S  s

S SS Ss

S Ss Ss

To eliminate the genes for black coat in a flock of sheep, the farmer can selectively breed only the white-coated sheep and not allow any black-coated sheep to mate. This would ensure that only the dominant white coat allele is passed down to future generations.

In the cross between a brown mouse (BB) and a heterozygous black mouse (Bb), all the offspring will be brown if the black mouse parent contributes a "b" allele to each offspring. The probability of this occurring for all four offspring is 1/2 x 1/2 x 1/2 x 1/2 = 1/16 or 6.25%.

(a) The normal man is homozygous dominant for pigmentation (CC) while the albino woman is homozygous recessive (cc). The albino child inherited one recessive allele from each parent (Cc).

(b) If they have more children, the probability of each child being albino would be 1/4 (25%) since both parents are heterozygous carriers of the recessive allele.

(c) The albino man is homozygous recessive (cc) while the normally pigmented woman is heterozygous (Cc). All nine children being normally pigmented means that they all inherited at least one dominant allele from their parents, so the genotypes of the parents must be Cc and cc, respectively.

The rose-combed male is RR and both rose-combed females must also be RR to produce only rose-combed offspring. Female A must have only contributed R alleles to all 14 of her chicks, making them all RR. Female B must have contributed R alleles to 7 of her chicks and r alleles to 2 of her chicks, making her genotype Rr.

Let "A" represent the dominant axial flower position allele and "a" represent the recessive terminal flower position allele, while "T" represents the dominant tall plant allele and "t" represents the recessive dwarf plant allele. The gametes produced by each genotype would be:

(a) AaBB - AB, aB

(b) aaBB - aB

(c) AAbb - AB, aB

(d) AaBBCc - ABTC, ABTc, AbTC, AbTc

Lastly,

(a) If a homozygous black pacer (BBtt) is mated with a homozygous chestnut trotter (bbTT), all the offspring (F1 generation) will be heterozygous black pacers (BbTt).

(b) If two F1 individuals (BbTt) were mated, they could have the following offspring: 1/16 BBTT (homozygous black pacer), 3/16 BBTt (black pacer), 3/16 BbTT (black trotter), 9/16 BbTt (heterozygous black pacer or trotter).

(c) If an F1 male (BbTt) is mated with a homozygous

Read more about genotypes here:

https://brainly.com/question/1626661

#SPJ1

See full question below



In guinea pigs, short hair is dominant and long hair is recessive. A short-haired male and a short-haired female produced mostly short-haired offspring, but a few were long- 12 haired. Show how you can determine the ge- notypes of the parents.

In sheep, white coat is dominate. Black is re- cessive. Occasionally, a black sheep appears H in a flock. Black wool is worthless: How could a farmer eliminate the genes for black coat- from the flock?

>

A brown mouse is crossed with a heterozy gous black mouse. If the mother has a litter of four, what are the chances that all of them will be brown?

In man, normal pigmentation is due to a H dominant factor C, albinism to its recessive allele c. A normal man marries an albino woman. Their first child is an albino.

15. (a) What are the genotypes of these three people?

3 로

(b) If they have more children, what would they probably be like?

21 (a) If you cross a pure-breeding tall plant bearing red, round fruit with a pure- breeding dwarf plant bearing yellow, pear-shaped fruit, predict the appear- ance of the F, generation.

Hey I really need help on these genetics problems all of them

One or two countries reducing their CFC emissions will not be enough to stop ozone depletion globally. What do you think the countries of the world should do to reduce CFC emissions?

Answers

All the countries of the world need to lower their emission rates in order to reduce CFC emissions globally.

What are CFCs?

CFCs is an acronym for chlorofluorocarbons, a group of non-toxic gases consisting of atoms of chlorine, fluorine, and carbon.

The compounds are found artificially in products like aerosol sprays, old refrigerants, and many other man-made products invented to make life generally better for humans. The gases are considered generally safe and unreactive in lower atmospheres down here.

In the stratosphere, however, CFCs are highly reactive. They undergo photolytic decomposition, a process that is largely catalyzed by the availability of UV light in the stratosphere. When this happens, chlorine molecules are released.

The free chlorine molecules react with the protective ozone layer and as a result, the ozone layer gradually gets destroyed. A single chlorine molecule can react with 100,000 ozone molecules.

Thus, in order to protect the ozone layer by reducing the emission of CFCs, all the countries in the world need to put their hands on deck. The whole world shares a single atmosphere. Thus, CFCs released in one part of the world eventually circulate to every part of the world.

More on CFCs and ozone layer can be found here: https://brainly.com/question/14330630

#SPJ1

Please help mee! Picture shown!!!!

Please help mee! Picture shown!!!!

Answers

Answer:

The answer to the question is -17

-17 ................

Please show a picture of the labelled diagram

The fluid mosaic model of membrane structure was first proposed in 1972 by Singer and
Nicolson. The model describes in detail how the components of a membrane are organised.
(a) Some of the components of the cell surface membrane are:
phospholipid molecules
protein molecules
cholesterol molecules.
(i) In the box below, draw a labelled diagram of a section through a cell surface
membrane to show how the above components are organised within the membrane.
The diagram should include other named components of the membrane.
Label the inner and outer surfaces of the membrane.

Answers

This is a labelled diagram of the labelled diagram
Please show a picture of the labelled diagram The fluid mosaic model of membrane structure was first

Describe how gene therapy can be a social issue and give rise to moral, ethical and legal debates. Justify your response in two or more complete sentences in the essay box below.

Answers

Answer:

Gene therapy is the process or replacing mutated genes with normal genes in an attempt to heal diseases by correcting the functional code of the gene. Mutated genes can cause genetic disorders. Transformation and transfection are the two methods used to insert a normal gene into an organism. The process of transformation occurs in a laboratory. Cells are grown in the lab and then introduced to DNA that carries the gene of interest. Transfection uses a virus to introduce the gene of interest to the host cells.

Gene therapy is a relatively new biotechnology. It is very expensive and much more research needs to be done before it is perfected. Gene therapy has had the best results in the treatment of cancer. One of the ways gene therapy is used in cancer treatment is by inserting a gene that is more sensitive to treatments such as chemotherapy and radiation.tion:

Gene therapy can be a social issue by the process or replacing muted genes with normal genes while attempting to heal a sickness of a bad function in one. Mutated genes can cause genetic disorders. Transformation and transfection are the two methods used to insert a normal gene into an organism. The process of transformation occurs in a laboratory. Cells are grown in the lab and then introduced to DNA that carries the gene of interest. Transfection uses a virus to introduce the gene of interest to the host cells.Gene therapy is a new biotechnology. It is very expensive and much more research needs to be done before it is perfected. Gene therapy has had the best results in the treatment of cancer. By adding a gene that can handle radition theropy you can go through it without a problem.

Which type of replication error would be most likely to result in genetic variation among organisms

Answers

The type of replication error that would be most likely to result in genetic variation among organisms is a mutation.

Mutations are changes in the DNA sequence that occur during the replication process. They can introduce new genetic variations by altering the sequence of nucleotides in the DNA. Mutations can be caused by various factors, including errors in DNA replication, exposure to mutagenic agents (such as radiation or certain chemicals), or spontaneous changes in the DNA structure.

When a mutation occurs in the DNA of an organism, it can lead to changes in the genetic information. These changes can be beneficial, detrimental, or have no significant effect on the organism's phenotype. However, if a mutation provides a survival advantage or increases an organism's reproductive success, it may be selected for and passed on to future generations, resulting in genetic variation.

The occurrence of mutations is a natural and ongoing process in the evolution of organisms. It contributes to genetic diversity, allowing populations to adapt and respond to changes in their environment over time. Therefore, mutations are the primary replication error that leads to genetic variation among organisms.

For more such answers on genetic variation

https://brainly.com/question/23840938

#SPJ8

Other Questions
Travis is reading Wonder after school. The thing is, because of the way my face is, people who don't know me very well don't always get that I'm smiling. My mouth doesn't go up at the corners the way other people's mouths do. It just goes straight across my face. But somehow Jack Will got that I had smiled at him. And he smiled back. He is not sure that he understands what he is reading. What will most help Travis understand the paragraph? Travis can look online at pictures of smiling faces. Travis can read an encyclopedia article about mouths. Travis can reread the paragraph and create a mental picture of Augusts smile. Travis can keep reading the story and hope he understands later. Select the correct answer from each drop-down menu. Solve the given differential equation by an appropriate substitution. A consumer's attitude toward apple is formed because she has developed _____ over time that apple's products are cutting-edge, innovative, and must-haves please help me answer it which set does square 7 belong to? integers and irrational numbers irrational and real numbers real and rational numbers rational and whole numbers Simplify the quantity 9 minus two thirds times the square root of 9 end quantity squared plus the quantity 1 minus 6 end quantity squared. 74 24 495 1,225 PLS HELP!!! I WILL MARK THE FIRST GOOD ANSWER BRAINLIEST!!!Johnsons goals for Reconstruction included all of the following EXCEPT:a.Create a provisional government to help states transition back into the Unionb.Reestablish law and orderc.Establish that the federal government has sovereignty over the statesd.Build prisons to hold former Confederate leaders and officers. what evolutionary advantage does compartmentalization of core metabolic processes offer eukaryotes? responses Which equation describes a circle with center (-1, 2) passing through the point (2, 4)? a (x + 1)2 + (y - 2)2 = 13 b (x - 1)2 + (y + 2)2 = 13 c (x + 1)2 + (y - 2)2 = 169 d (x - 1)2 + (y + 2)2 = 169 what two muscles form the crease in the axilla for axilllary block portugals trading post empire (orange dots are the cities they controlled) which nation was inspired by portugals success? A cake measures 18 centimeters in diameter. Find how much room there is to spread frosting on the top of the cake.Complete the answer sentence. You may consider writing your answer to the hundredths place and using the calculator to help you solve. 2. In chapter 2. Anita says, "It doesn't make any sense. If the SIM are policemen, secret or not, shouldn'twe trust them instead of being afraid of them?". Based on the quote, prior to asking this question, how didAnita feel towards authority? Write a thank-you letter to your fiend who lent you his/her book. Tellhim/her how useful the book proved to you, An Ixl question from sixth grade IXL:FF.15 Rectangles: relationship between perimeter and area When a market is internally efficient, it means that the market has a. price continuity. b. minimal transactions costs. c. more buyers than sellers. d. good depth correct answer gets brainliest if f(x) = 4x - 20, what is f(4)? we have been hearing and reading incident that senior citizen are being neglected by the family members. what may be the reason and measure for its solution?