Which of the following is NOT true of spiral galaxies?
A. New star formation is common in the arms.
B. They have a central bulge containing mostly older, red stars.
C. They are the dimmest of all galaxy types.
D. Gasses and stars are more concentrated in the arms.

Answers

Answer 1

Answer:

C is not sprial galaxy i think


Related Questions

thirst occurs when: select one: a. the mucosa of the mouth loses water. b. water intake exceeds water output. c. increased osmotic pressure of the blood stimulates the hypothalamus. d. shifts in sodium concentrations stimulate the cerebral cortex.

Answers

Thirst is the sensation or desire to drink fluids, usually water, in response to the body's need for hydration. Thirst is regulated by a complex system involving various physiological mechanisms, including the osmoreceptors in the hypothalamus of the brain. Option c is correct.

When the osmotic pressure of the blood increases, indicating a higher concentration of solutes such as salt, it can trigger the osmoreceptors in the hypothalamus to signal the sensation of thirst. This is a mechanism to maintain the body's water balance and prevent dehydration. Option c, "increased osmotic pressure of the blood stimulates the hypothalamus," accurately describes the physiological trigger for thirst.

Learn more about “ osmotic pressure “ visit here;

https://brainly.com/question/31411152

#SPJ4

.
What is the best way to classify a Goliath bird-eating spider?
omnivore
carnivore
herbivore

Answers

The answer is a carnivore

What would the alleles be for the following organism?
A pea plant is homozygous dominant for yellow seeds (Y).

YY

Yy

yy

None of the above

Answers

Answer:

YY

Explanation:

Homozygous Dominant means that there are two identical dominant alleles (YY). Therefore, if one of the given alleles is dominant (Y), then for homozygous, both will be dominant (YY).

A) YY is your answer.

If it is heterozygous, then it will have alleles of (Yy) or (yY). If it is homozygous recessive, then the alleles will be (yy).

Learn more about homozygous dominant, here:

https://brainly.com/question/27914577

Another name for a convex lens is a converging lens. Converging means…

A. Brings light into focus (beams come together)

B. Spreads light our or focus (beams spread apart)

Answers

Answer:

A

Explanation:

Answer:

A. Brings light into focus (beams come together)

Explanation:

Converging lens or convex lens is a type of lens on which parallel rays of light after refraction converge or meet at the focus of the lens.

Hope it helps.

If you have any query, feel free to ask.

Another name for a convex lens is a converging lens. Converging meansA. Brings light into focus (beams

The genotype of the F1 generation of flies in Bottle C must be A. NN B. there is more than one genotype possible c. nn D. Nn

Answers

The genotype of the F1 generation of flies in Bottle C can be determined by analyzing the traits of the parent generation. The correct answer is D) Nn.

Assuming that Bottle C represents a cross between two homozygous parent flies, one with the dominant trait (N) and the other with the recessive trait (n), the F1 generation will inherit one allele from each parent and will have a heterozygous genotype of Nn.

Therefore, the correct answer is option D, Nn. This is because the dominant allele (N) will mask the recessive allele (n), resulting in the expression of the dominant trait.

However, the recessive trait will still be present in the genotype of the F1 generation.

It is important to note that without additional information on the traits and genotype of the parent generation, it is not possible to determine the genotype of the F1 generation with certainty.

Therefore, option B, there is more than one genotype possible, cannot be ruled out. However, assuming a simple Mendelian inheritance pattern, option D, Nn, is the most likely genotype for the F1 generation in Bottle C.

For more such answers on genotype

https://brainly.com/question/30460326

#SPJ11

The genotype of the F1 generation of flies in Bottle C must be Nn. So the correct option is D.

The genotype refers to the genetic makeup of an individual, which consists of two alleles, one inherited from each parent. In the case of the F1 generation of flies in Bottle C, we know that the parents had the genotypes NN and nn, respectively.

Since the NN parent contributed one N allele and the nn parent contributed one n allele, the F1 generation would have the genotype Nn, where N represents the dominant allele for normal wings and n represents the recessive allele for vestigial wings.

To know more about genotype,

https://brainly.com/question/29156144

#SPJ11

Why do you think it is important that our bodies can respond to stimuli around us?

Answers

Answer: it is important that our bodies can respond to stimuli around us because without it, you wouldn’t be able to detect and respond to changes in their internal and external environment. Cells called receptors, which detect stimuli (changes in the environment). The stimuli is part of our control system, it is very vital.

List whether the following is an example of anatomy or physiology. A. Look at the microscopic structure of a tumor. B. Measuring respiratory rate during sleep. C. Measuring blood pressure during exercise. D. Observe a lesion to see if the border is irregular.

Answers

Answer:

. A. Look at the microscopic structure of a tumor. = Anatomy

B.Measuring respiratory rate during sleep.= Physiology

C. Measuring blood pressure during exercise.  = Physiology

D. Observe a lesion to see if the border is irregular. = Anatomy

Explanation:

GIVING BRAINLEIST!!!!!!

GIVING BRAINLEIST!!!!!!

Answers

Answer:

i would say C.

Explanation:

They have a PH of 7

Answer:

The answer is A.

What happens when you combine two clear liquid solutions, a thick black solid material forms on the bottom of the beaker.

Answers

Answer:

See explanation

Explanation:

A precipitate is formed when a mixture of two soluble substances results in the formation of an insoluble product. It usually happens during a double decomposition reaction.

The two clear liquids combined both contain soluble substances. These interact to yield an insoluble product also known as a precipitate which is black in colour and settles on the bottom of the beaker.

6. In a population which is in Hardy-Weinberg equilibrium, what would be the frequency of heterozygotes for
alleles A and a (i.e. genotype Aa), when the frequency of the allele a is 0.6?

a. 1.2
b. 0.16
c. 0.48
d. 0.45

Please show formula. I am lost

Answers

1.2 is correct aanser

yes it is correctly

TRANSLATE the mRNA sequence below into an amino acid sequence
using your preferred codon chart. Type the ONE-LETTER CODES FOR
AMINO ACID SEQUENCE AS YOUR ANSWER. DO NOT use dashes or
anything else to separate your letters.
Type the amino acid sequence you get as your answer. *Use the 1-letter codes for
the amino acids* DO NOT PUT SPACES, DASHES, OR COMMAS BETWEEN THE
LETTERS!! NOTE: The amino acids should spell a WORD if done correctly.
mRNA AACAUGAUGGCCAAAGAGUAAGCCA

TRANSLATE the mRNA sequence below into an amino acid sequenceusing your preferred codon chart. Type the

Answers

METHIONINE-VALINE-ALANINE-PROLINE-LYSINE-SERINE-ALA is the amino acid sequence that is encoded by the mRNA sequence AACAUGAUGGCCAAAGAGUAAGCCA.

Thus, the method through which the genetic material contained in an mRNA sequence is utilized to create a protein. Codons, which stand for groups of three nucleotides that denote certain amino acid sequence, are read from the mRNA sequence.

The start codon, AUG, initiates the production of proteins and codes for the amino acid methionine. The remaining amino acids in the sequence are then encoded by the following codons in the mRNA sequence. The shape and function of the protein that is eventually formed are greatly influenced by the resultant amino acid sequence.

Learn more about the amino acid sequence here:

https://brainly.com/question/13266141

#SPJ1

Help me on this plz get this correct

Help me on this plz get this correct

Answers

Answer:

1. Eagle

2. Primary

3. The population of snails would go up

4. The same amount i believe

5. The Mitochondria

What are the two inputs for aerobic cellular respiration?

a. oxygen and glucose
b. carbon dioxide and atp
c. carbon dioxide and water
d. glucose, atp and water

Answers

A is your answer and Hey

Oxygen and glucose are the two inputs for aerobic respiration.

What are Cellular respiration?

The process of cellular respiration involves the oxidation of biological fuels in the presence of an inorganic electron acceptor, like as oxygen, to generate significant amounts of energy that are used to power the major creation of ATP.

The process of converting chemical energy from foods into adenosine triphosphate (ATP) in an organism's cells, followed by the discharge of waste products, is known as cellular respiration. 

During catabolic reactions, which divide big molecules into smaller ones and release energy, respiration takes place. One of the main mechanisms through which a cell releases chemical energy to power cellular activity is respiration.

Therefore, Oxygen and glucose are the two inputs for aerobic respiration.

To learn more about Cellular respiration, refer to the link:

https://brainly.com/question/29760658

#SPJ2

Which organelle makes the proteins that are needed by the cell?
cell membrane
Golgi apparatus
ribosomes
nucleus

Answers

Answer: The answer is "Ribosomes".

Explanation: Ribosomes are responsible for making protein through amino acids. The proteins created are essential to cell and organismal function. Some ribosomes are attached to the endoplasmic reticulum (rough ER), others float freely within the cytoplasm.

Answer:

ribosomes is right

Explanation:

i just did it and passed sooooo

if the reverse transcriptase enzyme carried by a retrovirus was mutated and nonfunctional, how would the virus be affected?

Answers

The virus wouldn't be able to make DNA to ingest into the genome of the host.

As the first step in the creation of an infectious, lytic virus, excision of the prophage DNA from the host chromosomal DNA can occasionally result in the removal of some of the host cell DNA, which is packaged into defective bacteriophages; part of the bacteriophage DNA is removed and replaced at the other end by a gene of the host bacterial species. This type of virus is known as a transducing phage because, after infecting a bacterial cell, it can transfer the gene it has captured via phage DNA to the subsequent bacterial cell it infects. The effective transfer of genetic information from one bacterial cell to another is made possible by bacteriophages.

To know more about virus

https://brainly.com/question/16389883

#SPJ4

what is a gene
A. A series of DNA molecules.
B. A segment of protein.
C. A series of amino acids.
D. A segment of DNA molecule.

Answers

Answer:

D. A segment of DNA molecule

Explanation:

Gene is a segment of a DNA molecule that holds instruction needed for the synthesis of useful products (protein). Ideally, DNA is the storage material of genetic information in a cell. The DNA harbors the GENE, which itself is being expressed in order to use the information contained in it to produce useful products responsible for the phenotype of an organism.

A gene contains sequences made up of nucleotide bases that determines the sequence of amino acids to be produced, and ultimately the type of protein.

Answer:

A segment of DNA molecule

Explanation:

how do organisms guard against changes in the information contained in their dna? multiple select question. dna polymerase will not use mutated dna as a template. repair of damage on one strand can be carried out by using information from the complementary strand. proteins associated with dna can prevent mutations. damage to dna can be repaired through enzymatic activity. dna replication is carried out with very few copying errors.

Answers

Repair of damage on one strand can be carried out by using information from the complementary strand. Damage to DNA can be repaired through enzymatic activity. DNA replication is carried out with very few copying errors.

What do you mean by DNA?

All living organisms contain nucleic acids, which are organic substances, in the form of DNA or RNA.  To create these nucleic acids, different linkages bind these nitrogenous bases, sugar molecules, and phosphate groups in a series of sequential steps. The DNA structure determines our body's basic genetic make-up. In actuality, it describes the genetic composition of almost all species on earth.

Three different mechanisms protect organisms from alterations in the genetic information stored in their DNA:
(1) DNA replication is carried out with extremely few copying errors
(2) DNA damage can be repaired by enzyme activity
(3) Using knowledge from the complementary strand, one strand's damage can be repaired.

Therefore the correct statements are:

Repair of damage on one strand can be carried out by using information from the complementary strand. Damage to DNA can be repaired through enzymatic activity. DNA replication is carried out with very few copying errors.

To learn more about DNA go through the link given below

https://brainly.com/question/16099437

#SPJ4

The chief of staff at the hospital asks if it is possible this fungal pathogen is related to the tropical fungus the disease specialist, your colleague, at the BC CDC mentioned. The disease specialist answers the question by stating that it is possible and explain that although the tropical fungus species may have been transported to Vancouver Island years earlier, it may not caused any illness until now because the tropical fungus may not have been able to cause an infection due to being in a different environment that it was adapted to. However, through the process of natural selection acting on mutations, the original fungus could have evolved adaptations enabling it to successfully infect individuals in this new environment. Do you think the disease specialist's explanation is plausible based on what you know about evolution by natural selection?

Answers

Answer:

Explanation:

Yes, the disease specialist's explanation is plausible based on what we know about evolution by natural selection. Let me break it down for you in simpler terms.

The disease specialist is suggesting that the tropical fungus mentioned by your colleague might be related to the fungal pathogen causing the illness at the hospital. They explain that even though the tropical fungus may have been brought to Vancouver Island some time ago, it might not have caused any illness until now. This could be because the tropical fungus was originally adapted to a different environment and couldn't infect people in the new environment of Vancouver Island.

Now, here's where evolution by natural selection comes into play. Over time, organisms can undergo changes in their traits and abilities through a process called natural selection. Mutations, which are changes in the genetic material of organisms, can happen randomly. If a mutation occurs in the tropical fungus that enables it to infect individuals in the Vancouver Island environment, it could be favored by natural selection.

For example, let's say that due to a mutation, the tropical fungus developed adaptations that allowed it to thrive in the new environment and infect people. These adaptations might include changes in its ability to penetrate human cells or evade the immune system. As a result, the fungus would become more successful at causing infections in the Vancouver Island population.

So, the disease specialist's explanation is plausible because it suggests that over time, through natural selection acting on mutations, the original tropical fungus could have evolved adaptations that made it capable of causing illness in the new environment of Vancouver Island.

Consider that basilosaurus lived in the ocean, how has the environment of this location changed since basilosaurus lived?

Answers

Answer:

Explanation:

This is because basilosaurus lived in the aquatic region with it sturdy slippers and long body.There was change in the environment due to the shifting that occur to tectonic plates and marking a portion of the land to move to a higher altitude or block the inflow of water from being in the deserted place.

The function of the nervous system is to

Answers

Explanation:

The nervous system is involved in receiving information about the environment around us (sensation) and generating responses to that information (motor responses). The nervous system can be divided into regions that are responsible for sensation (sensory functions) and for the response (motor functions).

Where is a thylakoid placed?

Answers

Answer:

They are located within the chloroplasts.

Explanation:

Answer:

It is located in the stroma (an interior part of the chloroplast)

v-FLIPs are viral proteins that were first identified as modulators of apoptosis; they contain two death effector domains, which are also found in some initiator caspases such as procaspase-8. These v-FLIP proteins can be recruited to the DISC through the binding of the death effector domain to similar domains in the adaptor proteins but are otherwise catalytically inactive. What do you think is the effect of v-FLIP expression in the host cell?A. It promotes apoptosis mainly via the extrinsic pathway.B. It inhibits the extrinsic pathway of apoptosis.C. It activates only the mitochondrial pathway of apoptosis.D. It inhibits the intrinsic pathway of apoptosis.E. It enhances the caspase cascades in both the intrinsic and extrinsic pathways.

Answers

Answer:

B. It inhibits the extrinsic pathway of apoptosis

Explanation:

Apoptosis is a cellular pathway that leads to programmed cell death. Viral FLICE-inhibitory proteins (FLIPs) bind to the adaptor proteins and block the interaction between the DISC complex with the caspase-8 protease enzyme, which triggers apoptotic cell death. In consequence, cells become resistant to Fas-mediated apoptosis, a pathway initiated by the FADD protein which is known to recruit caspase-8.

For the genetic drift simulation, what event led to changes in the size of the population?.

Answers

A catastrophe or natural disaster event changed the population's size in the genetic drift experiment. Genetic drift is the term used to describe a population's allele frequencies changing randomly and without selection.

Small populations typically lose their genetic diversity faster than large populations do due to stochastic sampling error. This is because it is more likely that some gene variants will be lost in small populations due to chance. Genetic drift is an unpredictable process that can swiftly result in large population changes. Regularly tiny population numbers, drastic population size reductions known as "bottlenecks," and founder events where a new population is created from a small number of individuals are all factors that contribute to random drift.

So, in the genetic drift experiment, we may argue that a catastrophe or natural disaster event affected the size of the population.

LEARN MORE ABOUT GENETIC DRIFT HERE:

https://brainly.com/question/12985618

#SPJ4

Your question is incomplete. Please find the complete question below.

For the genetic drift simulation, what event led to changes in the size of the population?

A. a natural disaster or catastrophe

B. immigration

C. selective predation

D. inbreeding

A common mineral found in igneous rocks is the most abundant mineral in detail sedimentary rocks

Answers

Answer:

Feldspar

Explanation:

How does a Covalent Bond Form? ( No goo.gle ik the goo.gle answer cause i tryed looking it up if you put tht answer u wont get brainliest)

Answers

Answer:

A covalent bond forms when the difference between the electronegativities of two atoms is too small for an electron transfer to occur to form ions. Shared electrons located in the space between the two nuclei are called bonding electrons. The bonded pair is the “glue” that holds the atoms together in molecular units.

Answer:

A covalent bond forms when the difference between the electronegativities of two atoms is too small for an electron transfer to occur to form ions. Shared electrons located in the space between the two nuclei are called bonding electrons. The bonded pair is the “glue” that holds the atoms together in molecular units.

Explanation:

Which describes a feature of the physical properties of all substances? A) Can dissolve in water. B) Can conduct heat and electricity. C) Rearranges atoms to form new substances. D) Does not change the identity of a substance.

Answers

Answer: D

Explanation:

The features that give description of the physical properties of substances as regards this question is Does not change the identity of a substance.

physical property of a substance can be regarded as those features The features that give description of the physical properties of substances as regards this question is Does not change the identity of a substance.

physical property of a substance can be regarded as those features as well as characteristic of that substance which can undergo observation as well as  measurement and after measurement the substance will still retains it's  identity.

This implies identify doesn't change.

Physical properties of a substance can include properties such as ;

 color

density

boiling points

hardness

melting.

Therefore, option D is the right answer.

Learn more at: https://brainly.com/question/2116116?referrer=searchResults

Radioactive dating is calculated by:

Radioactive dating is calculated by:

Answers

It is a tool that is used to determine the age of materials like rocks. It is based on a comparison, using known decay rates, between the observed abundance of a radioactive isotope which occurs naturally and its decay products.

Time left 1:53:51
Suppose you are designing a clinical trial that is aimed at testing if the drug Hydrochlorothiazide (HTZ) reduces blood pressure
in patients with high blood pressure. In the experimental group for this trial, 50 female patients with high blood pressure are
given 12.5 milligrams HTZ in pill form. Which of these would be appropriate design for the control group?

Answers

The control group should consists of 50 women who receive an identical looking pill that does not contain the drug.

In an experiment, the control group serves to establish the validity of the experiment. The experimental group is the group that receives the treatment while the control group is the group that did not receive the treatment. In this case, the treatment is the drug Hydrochlorothiazide (HTZ) which reduces blood pressure.

In the control group, 50 women who have high blood pressure could be given an identical looking pill that contains no Hydrochlorothiazide (HTZ) which reduces blood pressure.

Learn more: https://brainly.com/question/8646601

Time left 1:53:51Suppose you are designing a clinical trial that is aimed at testing if the drug Hydrochlorothiazide

Help me with this please

Help me with this please

Answers

Answer:

1,307.75

Explanation:

first: (10x86) + (6.25×163) - (5×82) - 161

(860)+ (1,018.75)-(410)-161

1,468.75-161=

1,307.75

Remember to calculate the nearest whole number

Consider an individual with red-green colour deficiency.What is the minimum possible number of the child's GRANDPARENTS who were also red-green colour deficient?*note* Please enter numbers only - (0-4)

Answers

As the character is recesive and humans are diploid, the idividual must have both alleles with the information for red-green colour deficiency if she is a woman, or the only allele with that information if he is a man; this is because the gene for colour deficiency is located on the sexual chromosome X.

Therefore, if both grandmothers have the allele for colour deficiency but they have a heterozygous genotype, neither of the grandparets would have colour blindness, even though, they could give their offspring the red-green colour deficiency allele.

To sum up, 0 grandparents can be red-green colour deficient (but at least one must have the corresponding allele) and have a grandson/daughter with red-green colour deficiency.

Other Questions
Just help for 15 points help please I'm timed!, I'll give brainliest, and a thanks! History homework help please and thank you all Hello, I really need some help with this problem. I will give 10 points! helen tells her mother that girls cannot be president, only boys. helen is at least what age? how can I solve this problem ?(x-2x-2x+1)(x-1) preganglionic fibers leave the cns and then synapse on visceral reflex responses. postganglionic fibers. motor neurons. afferent neurons. ganglionic neurons. What is 20 miles per hour in feet per second? round to the nearest tenth if necessary. What is the main purpose of Washington'sFarewell Address? Mario answered 20 out of 25 questions correct on his test. What percentage did he getcorrect?A 20%B. 50%C. 60%D.80% Which of the following rational functions is graphed below? given 0.10 m solutions of the four weak acids in the chart above, all with 0.10 m concentration, which will have the greatest percent ionization? Write the equation of the line that passes through the points (4,5) and (4, -6). Putyour answer in fully reduced point-slope form, unless it is a vertical or horizontal line. To which number set(s) does the following number belong?-11 whats 105 to the power of 20 pls help its big question Which forms a larger image on the retina of your eye: a 43 ft tree seen from a distance of 210 ft, or a 12 in flower viewed from a distance of 2 ft? Ans: if you are at a crime scene and ignore the violence around you, instead solely focusing on the needs of an injured victim, you may be guilty of __________. Consider a material that can exist in two distinct phases, and , depending on the pressure and temperature. At any point along the coexistence line in the phase diagram, the Gibbs free energy of the two phases is the same: G (P, T) = G (P, T). In this problem, you will derive some useful properties of the slope of the coexistence line.The coexistence line is a function P(T). Imagine the system is at coexistence. Write down theexpression for how G changes if you make a small change in pressure and temperature, anddo the same for G. If you want to stay on the coexistence line after such a change, youcannot change P and T independently; you have to change them in a specific ratio.a) Calculate this ratio dP/dT in terms of the entropies and volumes of the two phases.b)Rewrite the expression you found in part a) in terms of this latent heat H and the change in volume V = V V.c) Lets assume that we are interested in the transition from a liquid (Phase ) to a gas (Phase ). The gas has a much greater than volume, so you can assume that V V. Use theideal gas to simplify the expression for the slope of the coexistence line.d) the coexistence line between the solid and liquid phases of water has a negative slope. Given your result from part b), what does that imply for the densities of ice and liquid water? List the reasons that lennie gives to explain how the puppy is responsible for its own death. are lennies arguments valid? why or why not? I just need to fill the table out