The organ that assists in the filtration of blood, serves as a blood reservoir, and produces antibodies is the spleen.
The spleen is a fist-sized organ located in the upper left side of the abdomen, near the stomach. It is responsible for filtering the blood and removing old and damaged red blood cells, as well as cellular debris and bacteria. The spleen also serves as a blood reservoir, storing up to one-third of the body's blood supply, which can be released into circulation when necessary. Additionally, the spleen produces and stores white blood cells, including lymphocytes, which play a key role in the immune system's defense against infections and foreign substances by producing antibodies. The spleen is therefore essential for maintaining the health and function of the body's circulatory and immune systems.To know more about organs visit:
https://brainly.com/question/4144685
#SPJ4
Which form of energy is due to the motion of an object’s particles?
Answer:
Kinetic Energy
Explanation:
True or false when a haploid sperm and a haploid egg join the result is a diploid cell  
Answer: true
Explanation:
Once fertilized, the egg is called a zygote. Fertilization is not complete, however, until the two haploid nuclei (called pronuclei) have come together and combined their chromosomes into a single diploid nucleus.
Flowering plants are ___.
A.) gymnosperms
B.) laurasians
C.) angiosperms
D.) archaeopteryx
Answer:
C
Explanation:
The flowering plants, also known as Angiospermae, or Magnoliophyta, are the most diverse group of land plants, with 64 orders, 416 families, approximately 13,000 known genera and 300,000 known species. Like gymnosperms, angiosperms are seed-producing plants. They are distinguished from gymnosperms by characteristics including flowers, endosperm within their seeds, and the production of fruits that contain the seeds. Etymologically, angiosperm means a plant that produces seeds within an enclosure; in other words, a fruiting plant. The term comes from the Greek words angeion and sperma.
differentiate 10sinxcosx
Answer:
\(10\,cos\,2x\)
Explanation:
To differentiate: \(10\,sinx\,\,cos x\)
Solution:
Use product rule: \([f(x)g(x)]'=f'(x)g(x)+f(x)g'(x)\) and the following formulae:
\((sinx)'=cosx\,,\,(cosx)'=-sinx\)
\((10\,sinx\,\,cos x)'=10[(sinx)'cosx+(sinx)(cosx)']\\\\=10[cosx\,cosx-sinx\,sinx]\\\\=10[cos^2x-sin^2x]\)
Use \(cos^2x-sin^2x=cos2x\)
\((10\,sinx\,cosx)'=10\,cos2x\)
Can you do this exercise for me, it is really urgent:
SITUATION
Stephen drinks alcohol every day. He has an addiction to alcohol but doesn't realize it. Although his friend Mehdi has pointed it out to him several times, Stephen says he can stop whenever he wants. Recently, Stephen had an accident at work due to a careless mistake after drinking. He decides to react and to go and see an addictologist.
Answer:
(I am not fluent in French, but here is what I interpreted) The problem is alcohol usage
Explanation:
The problem is his excessive use of alcohol causing a mistake at work
His friend Mehdi is concerned
It doesn't state when the addiction started and only that the mistake at work happened recently
Stephen is now seeing an addictilogist
The problem is getting worse because he wouldn't acknowledge that he had a problem
please help. Due in the morning.
Answer: See below
Explanation:
The Male P1 Mouse: BB
The Female P1 Mouse: bb
The first photo shows the genotype of the F1 generation, they are now heterozygous because they contain different alleles (Bb).
The black B is the dominant trait so they will all be black because they all have that B allele.
The second photo shows the F2 generation and shows that one of the four offspring would have bb which would be white while all others will be black.
Please need help with this biology question (photo)
Answer:
Energy flows through the organisms from bottom to top and increases at each level.
Explanation:
Dominant traits are....
A. traits that everyone wants
B. traits that are shown over other traits
C. Traits that are hidden by other traits
D. traits that no one wants
Answer:
b. traits that are shown over other traits.
Answer:
OK the answer is B traits that are shown over other traits is correct for sure I did this in my school and got correct
What is the phenotype?
One of two identical "sister" parts of copied chromosomes
One member of a pair of genes that occupy a specific position on a specific chromosome
The genetic makeup of an organism
The observable physical or biochemical traits of an organism
Answer:
The observable physical or biochemical traits of an organism
Explanation:
I took the test and got it right
The phenotype is the observable physical or biochemical traits of an organism.
What is phenotype?It refers to observable physical properties of the an organism.
What is biochemical traits?It describes species physiology, morphology, life history and behaviorIt capture both inter-specific interaction and connection between species and their environment.Example: height , skin color , hair color and eye color of humanlearn about phenotype,
https://brainly.com/question/20730322
#SPJ2
Without replication, organisms could not successfully
move.
grow and reproduce.
feed.
make proteins.
Answer: grow and reproduce
Explanation:
How have federal and state authorities attempted to eradicate Burmese Pythons from the Everglades?
Answer:
As evidence of the python’s damaging spread became clearer, state and federal authorities began working together in an attempt to eradicate the python population. In 2010, the state made python pet ownership illegal.
Explanation:
Help I'm confused!
This is the beginning sequence of the first exon in the mRNA sequence:
AUGAAGCUCUUUUGGUUGCUUUUCACCAUU
Give the DNA/genomic sequence it was transcribed from.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
DNA originally contains two parent strands, each forming one side of the double helix. After replication, each of these parent strands is copied into a daughter strand, so the overall result is 2 identical daughter cells. The process of DNA replication. In a semi-conservative model of DNA replication, which of the following is true?
The daughter DNA molecule consists of 1 parent strand and 1 new strand
The daughter DNA molecule consists of 2 newly formed strands
The daughter DNA molecule consists of 2 parent strands
The daughter DNA molecule consists of an uneven mix of old and new strands
DNA replication is semi-conservative because the original molecule separates into two different strands, and each of them works as a model for a new strand to grow. A) The daughter DNA molecule consists of 1 parent strand and 1 new strand.
Why is DNA replication a semi-conservative event?
DNI replication is semi-conservative because, after replication, each new molecule carries an original DNI strand and a new one. The fact that the new molecule is composed of an original strand makes it semi-conservative. The old existing strands are used to synthesize the new complementary strand.
The replication products are double-stranded DNA molecules, each carrying an original strand and a new one.
The correct option is A) The daughter DNA molecule consists of 1 parent strand and 1 new strand.
You can learn more about the semi-conservative model of DNA replication at
https://brainly.com/question/23278374
#SPJ1
In a semi-conservative model of DNA replication, the daughter DNA molecule consists of 1 parent strand and 1 new strand. Option 1.
Semi-conservative DNA replicationThe process of DNA is naturally semi-conservative.
This is because each strand of the original DNA forms a template for the synthesis of a complementary strand. Thereafter, each of the newly synthesized strands forms a double helix structure with their respective parent strands.
Thus, e newly replicated DNA molecule usually consists of 1 old strand and 1 new strand. Consequently, the process is described as being semi-conservative.
More on DNA replication can be found here: https://brainly.com/question/16464230
#SPJ1
2. A catalyst lowers the activation energy bya. reducing the overall temperature.b. destabilizing bonds in the substrate.c. changing the order of amino acids.d. adding energy to the substrate.e. all of the above.
A catalyst speeds a reaction because it reduced the transition energy and in turn lowers the activation energy. Therefore taking this into consideration we can proceed to analyze each available option.
a. reducing the overall temperature. This is not correct as the temperature does not depend on the catalyst.
b. destabilizing bonds in the substrate. This is not correct as this depends on the reaction.
c. changing the order of amino acids. This is not correct as amino acids have a specific order in proteins and are built by ribosomes.
d. adding energy to the substrate. This is correct, more than adding energy facilitates the process due to a reduction in the transition energy.
e. all of the above. This is not correct as many of them are incorrect too.
PLEASE HELP L 2.3.2 Test (CST): Evolution
Question 5 of 10
Data from the sequence of amino acids in proteins are
used to infer how living things are related through
evolution. The chart shows part of this sequence for
several organisms' cytochrome-c, a protein used to get
energy from food.
Organisms
Acid Sequences in Cytochrome-c
Based on the sequences shown in the data table, which two organisms are
most closely related?
O A. Kangaroo
B. Duck
C. Tuna
D. Sea star v
SUBMIT
Understanding the effects of alcohol will help me
The effects of alcohol are high blood pressure, heart disease, stroke, liver disease, and digestive problems.
What are the 5 effects of alcohol on the body?
High blood pressure, heart disease, stroke, liver disease, and digestive problems are the effects of alcohol. Cancer of the breast, mouth, throat, esophagus, voice box, liver, colon, and rectum also occur due to more consumption of alcohol. Weakening of the immune system, increasing the chances of getting sick, Learning and memory problems, dementia and poor school performance also the cause of alcohol.
So we can conclude that the effects of alcohol are high blood pressure, heart disease, stroke, liver disease, and digestive problems.
Learn more about alcohol here: https://brainly.com/question/27427140
#SPJ1
T Lymphocytes can bind proteins in their native form.
True or false
What does the line of blue triangles mean on a weather map?
1. a stationary front
2. an occluded front
3. a cold front
4. a warm front
PLS HELP ME WILL GIVE 100 PONITS:Explain how to compare 3 and 7 by writing the correct number or symbol in the blanks. 4 12
3 4 8 12 7 9 1
< > = 12 12 2
First, I would rewrite 3 as an equivalent fraction with a denominator of _____. 4
The equivalent fraction is ____. Then, I would compare the equivalent fraction to 7 . 12
So,
3 7
4 1
SUBJECT: science
Some examples of equivalent fractions include:
3/6 and 2/4 are both equivalents because they are equal to 1/225/50 and 50/100 are both equivalents because they are equal to 1/2, etcWhat is an Equivalent Fraction?This refers to the type of fractions that has different denominators and numerators but have the same value when broken down to the smallest terms.
Furthermore, some more examples of equivalent fractions are:
40/80 and 60/120 are both equivalents because they are equal to 1/2100/200 and 150/300 are both equivalents because they are equal to 1/2You should also note that equivalent fractions can be found by multiplying the numerator and the denominator by the same number and you would see if your fraction is an equivalent fraction or not.
Please note that your question is unclear, so I gave you a general overview to help you get a better understanding of the concept of equivalent fractions.
Read more about equivalent fractions here:
https://brainly.com/question/17220365
#SPJ1
Which of the following is TRUE about most newborns’ hearing and vision? Group of answer choices.
a) Their hearing improves during the first four months.
b)Their vision is better than their hearing.
c)Their hearing and vision are about the same.
d)Their hearing is better than their vision.
Answer:B
Explanation: At birth, a newborn's eyesight is between 20/200 and 20/400. Their eyes are sensitive to bright light, so they're more likely to open their eyes in low light.
It is TRUE about most newborns’ hearing and vision that Their hearing is better than their vision. Correct Option is 4.
Most newborns have better hearing than vision. Newborn infants typically have a well-developed auditory system, allowing them to respond to sounds soon after birth. They can perceive a wide range of auditory stimuli and are sensitive to different frequencies and intensities of sound.
On the other hand, their visual system is not fully matured at birth, and newborns have limited visual acuity and color vision. Their ability to focus on objects and perceive details improves gradually over time as their visual system develops. Therefore, during the early stages, newborns generally have better hearing capabilities compared to their vision.
Try to know more about newborns:
https://brainly.com/question/30705506
#SPJ2
What is the role of erythropoietin in the regulation of RBC count? What is the role of gastroferritin?
compare the relative energy storage of carbohydrates, lipids, and proteins.
Answer: compare the relative energy storage of carbohydrates, lipids and proteins carbohydrates is 4 calories/milligram. lipids are 9 calories/milligram. proteins are 4 calories/milligram list in order in which the body will consume carbohydrates, lipids, and proteins for energy and explain why
Explanation:
17
15. Some scientists use molecular evidence to study
evolution. One type of molecular evidence is
the amino acid sequence of particular proteins in
various species.
Which of the following best describes what the
study of these sequences reveals about the species?
A. The more similar the sequences are, the faster
the species will coevolve.
B. The more similar the sequences are, the more
closely related the species are.
C. The longer the sequences are, the earlier the
species evolved in geologic history,
D. The longer the sequences are, the more
adapted the species are to their environments.
Answer:
D
Explanation:
Because yes
1 What does the codon sequence on the mRNA strand determine?
A The gene sequence of the DNA
B The amino acid sequence of the polypeptide
C The codon that is signaled
D The signaling sequence
2 What portion of the DNA is also known as a gene?
A The coding sections
B The non-coding sections
C The mRNA strand
D The polypeptide sequence
1. The correct answer is B.
2. The correct answer is A.
The codon sequence on the mRNA strand determines the amino acid sequence of the polypeptide.
The coding section is the portion of the DNA that is also known as a gene. Genes are the functional units of DNA that provide the instructions for making proteins. They are composed of coding cells, also known as exons, that contain the information needed to build the polypeptide, and non-coding sections, also known as introns, that do not.
The codon sequence on the mRNA strand is translated by the ribosome during protein synthesis. Each codon, which is a sequence of three nucleotides, corresponds to a specific amino acid. The ribosome reads the codon sequence on the mRNA strand and adds the corresponding amino acids to the growing polypeptide chain. This process is called translation.
In DNA, genetic information is encoded in the sequence of nucleotides, which are the building blocks of DNA. Genes are specific segments of DNA that contain the instructions for making a specific protein. These instructions are encoded in the sequence of nucleotides within the coding sections of the DNA, also known as exons. The non-coding sections, also known as introns, do not contain instructions for making proteins, but they play important roles in the regulation of gene expression.
To learn more about codon sequence on the mRNA strand visit the link:
https://brainly.com/question/18607334
HELLP PLS ILL GIVE 2 BRAINLIESTS, 5 STARS, AND THANKS, AND 50 POINTS
Accoring to the data table, Molly observed rust on the sample of iron filing and dries the sample thoroughly. She then finds the mass of the entire sample and finds it has more mass than the 188g of the original sample. As the rusted iron filing occurred in an open system, which of the following best explains the increase in mass?
Select one:
A. The sample gained mass because rust is a different color than the iron fillings, and the different color rust has more mass that the original iron fillings.
B. The sample gained mass because the iron fillings combined with oxygen in a chemical reaction, thus making the final rusted sample to have more mass.
C. Molly made a procedure mistake when measuring the mass of the entire sample. She should remeausre her sample.
D. The sample gained mass because rust is a physical change and the color change causes the mass to be more than the original sample.
Answer:
I think you are looking for B
How does a food chain compare to a food web? *
Answer:
a food web is just a bunch of food chains connected
Explanation:
Eggs and sperm are examples of _____. zygotes somatic cells diploid cells gametes
Answer:
gametes
Explanation:
gradpoint
Pls help this is due in an hour!!!!
Answer:
Throughout their life cycles, frogs have an important place in the food chain as both predators and prey. As tadpoles, they eat algae, helping regulate blooms and reducing the chances of algal contamination. Frogs are an important source of food for a variety of animals, including birds, fish, monkeys and snakes.
Explanation:
Does anyone know what numbers are inside of ALL PHONES? Hint only 2. WILL GIVE BRAINLEST!
the answer is 0 and 1 like a computer
Explain what traits you would give a pathogen if you wanted to make it hard for a vaccine to be used. List at least 4 things help please
Answer:
Here are four traits that would make it hard for a vaccine to be used:
1. Rapid mutation rate. If a pathogen mutates rapidly, it will be able to evade the immune system's defenses, including the antibodies produced by a vaccine. This is a particular problem with viruses, which can mutate very quickly.
2. Ability to evade the immune system. Some pathogens are able to evade the immune system by hiding inside cells or by changing their surface proteins so that they are no longer recognized by the immune system. This makes it difficult for the immune system to mount an effective response to the infection.
3. Ability to spread easily. If a pathogen is easily spread from person to person, it will be more difficult to prevent infection through vaccination. This is a particular problem with respiratory viruses, which can be spread through coughing and sneezing.
4. Lack of animal reservoirs. If a pathogen does not have animal reservoirs, it will be more difficult to develop a vaccine against it. This is because vaccines are typically developed using weakened or killed versions of the pathogen. If there are no animal reservoirs, there will be no source of the pathogen to use for vaccine development.
It is important to note that these are just a few of the traits that can make it difficult to develop a vaccine against a pathogen. There are many other factors that can contribute to the difficulty of vaccine development, such as the cost of vaccine development, the availability of funding, and the political will to support vaccine development.