How are the functions of the endoplasmic reticulum and the Golgi apparatus related? A. Golgi apparatus receives proteins and other materials from the endoplasmic reticulum, packages them, and distributes them to vacuoles. B. The nucleus directs the cell's activity, including any transfer of material between the endoplasmic reticulum and the Golgi apparatus. C. Proteins and other substances made in the endoplasmic reticulum are stored, packaged, and distributed by the Golgi apparatus. D. In order to function, both plant and animal cells require an endoplasmic reticulum and Golgi apparatus.
Answer:
Proteins and other substances made in the endoplasmic reticulum are stored, packaged, and distributed by the Golgi apparatus
the scientific foundation of human development is based on what?
The scientific foundation of human development is based on the study of developmental psychology, which is the scientific discipline that studies how and why human beings change and grow throughout their life.
This field of study looks at the various stages of human development, including infancy, childhood, adolescence, adulthood, and old age, and examines the physical, cognitive, emotional, and social changes that occur during each stage. The study of human development is interdisciplinary, drawing on concepts and theories from biology, sociology, anthropology, neuroscience, and other related fields. It aims to provide a comprehensive understanding of the complex and dynamic nature of human development, and to inform interventions and policies aimed at promoting optimal development and well-being across the lifespan.
To know more about scientific foundation click here:
https://brainly.com/question/9964094
#SPJ11
the recommended duration for each cardiorespiratory exercise sessions is how many minutes?
Answer:
the recommended duration for each cardiorespiratory exercise sessions is 60 miutes
Explanation:
60 mins
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
The menopause is a developmental stage in women that is due more to genes than environment. It would not have evolved unless there were advantages for women, for families or for the community as a whole. What could these advantages be? Think at least two.
human hair from a grave in africa proved to have only 58% of the carbon 14 of living tissue. when was the body buried? the half life of carbon 14 is 5730 years.
The percentage of carbon-14 in human hair from a grave in Africa can be used to estimate the age of the body. Carbon-14 is an isotope of carbon that is present in living organisms. It undergoes radioactive decay over time, with a half-life of 5730 years.
In this case, the human hair from the grave had only 58% of the carbon-14 compared to living tissue. To determine when the body was buried, we can use the concept of half-life.
Since the half-life of carbon-14 is 5730 years, we can calculate the number of half-lives that have occurred by taking the logarithm of the remaining carbon-14 percentage. Using the formula:
Number of half-lives = (log(percentage remaining) / log(0.5))
In this case, the percentage remaining is 58%. Plugging this value into the formula, we get:
Number of half-lives = (log(58) / log(0.5))
Calculating this gives us the number of half-lives that have occurred since the burial.
Once we have the number of half-lives, we can multiply it by the half-life of carbon-14 to determine the age of the body. For example, if we find that 2 half-lives have occurred, we would multiply 2 by 5730 years to get the age of the body.
It is important to note that this method provides an estimate and may not be exact. Additionally, other factors such as contamination or natural variations in carbon-14 levels can affect the accuracy of the result.
Therefore, it is recommended to use multiple dating methods and consider other evidence to obtain a more accurate estimate of the burial age.
To know more about isotope visit:
https://brainly.com/question/28039996
#SPJ11
Environment A is warm and gets lots of rain. Environment B is warmer and gets more rain year round. Identify Environment
Environment A is characterized as warm and receiving a lot of rain, which suggests it could be a tropical or subtropical rainforest or a humid subtropical climate. On the other hand, Environment B is warmer and receives even more rain year-round, which could suggest a tropical rainforest or a humid equatorial climate.
It's important to note that these are generalizations and the specific location and geography of each environment would play a role in determining its exact climate classification.
Based on the descriptions provided, Environment A can be identified as a humid subtropical climate, characterized by warm temperatures and significant rainfall. Environment B can be identified as a tropical rainforest climate, which has even warmer temperatures and receives more rainfall throughout the year.
To know more about Environment visit:-
https://brainly.com/question/32323796
#SPJ11
The substance in which a solute is dissolved
Answer:
The substance in which a solute is dissolved is called solvent
Explanation:
mark me brainliest please
Animal cell
can you label what is what, please and thank you.
Answer:
This Is a photo to help out.
Explanation:
Using one of Newton's Laws of Motion -- explain what happened.
Answer:
newtons law number two
pitcher plants are carnivorous plants that grow in areas where the soil contains low levels of key nutrients such as nitrogen. to obtain these nutrients, most pitcher plants capture prey using traps containing a digestive fluid. the captured prey are then broken down and digested, and the pitcher plant absorbs the nutrients. the traps of one species of pitcher plant, nepenthes hemsleyana, do not contain digestive fluid. instead they provide a suitable place for woolly bats (kerivoula hardwickii) to sleep. the feces from the bat are released into the trap where nutrients in the feces are absorbed and provide the plant with the nitrogen it needs. which of the following best describes the relationship between the pitcher plant and the woolly bat? responses the relationship is an example of parasitism because the bat is harmed while the plant benefits. the relationship is an example of parasitism because the bat is harmed while the plant benefits. the relationship is an example of mutualism because both the plant and the bat benefit. the relationship is an example of mutualism because both the plant and the bat benefit. the relationship is an example of commensalism because the plant benefits but the bat is unaffected. the relationship is an example of commensalism because the plant benefits but the bat is unaffected. the relationship is an example of commensalism because the plant is unaffected while the bat benefits.
Primary succession happens when a pristine environment is exposed (lava flow). Pitcher plants are carnivorous plants that may survive in areas with little nitrogen in the soil.
The majority of pitcher plants catch animals using digestive fluid-filled traps in order to obtain these nutrients. Most plants get adequate nitrogen from the soil's nitrates. Carnivorous plants must obtain their nitrogen from the digestion of their food because nitrates are in short supply where they can flourish. Nepenthes plants are carnivorous and eat insects mostly for food. They accomplish this using specialised pitfall traps known as "pitchers," which draw in, capture, and devour insects.
To know more about carnivorous plants, click here:
https://brainly.com/question/11020241
#SPJ4
How to Determine the genotypes & phenotypes of the offspring?
What types of plants dominate subtropical deserts, and why are they so vulnerable to disrupon?
The type of plants that dominate subtropical deserts are the Perennial plants.
What is subtropical deserts?The subtropical deserts is a type of ecosystem that is known to have very little to no rainfall, very low humidity and very high or hot temperature through out the year.
Some countries that has this subtropical deserts include the following:
Asia, Australia, Africa and North and South America.The perennial plants are the types of plants that are seen in these subtropical deserts.
This is so because, they are the plants that survive for up to three growing season making them to live for more that two years.
Examples of perennial plants are purple coneflowers, coreopsis, Black-eyed Susans, sedum, daylilies, asters, astilbe, phlox and goldenrod.
The perennial plants are vulnerable to disruption because they have slow overall growth than other plants.
Learn more about deserts here:
https://brainly.com/question/25806979
#SPJ1
What is an ecological community?
Responses
!.small groups of the same species that live in an area and can breed with each othersmall groups of the same species that live in an area and can breed with each other
2.a group of different species of organisms that live in an area and interact with each othera group of different species of organisms that live in an area and interact with each other
3.members of a species that live in an area and can breed with each othermembers of a species that live in an area and can breed with each other
4. a group of different organisms that live in an area and do not interact with each other
Communities are all the individuals from different species that coexist and interact. Option 2. a group of different species of organisms that live in an area and interact with each other
What is a community?
A community might be defined as a group of organisms from different species that coexist in a certain time and space, and interact with each other. It can be defined at different scales.
Inter-specific interactions can cause changes in the populations' sizes. These could be the cases of competition, predation, parasitism, mutualism, and etcetera.
Option 2. a group of different species of organisms that live in an area and interact with each other
You can learn more about communities at
https://brainly.com/question/24220431
#SPJ1
A person without the allele for sickle cell anemia has children with a person who is a carrier for sickle cell anemia but doesn’t have the disease. What percentage of their children will have sickle cell anemia? What percentage of their children will be carriers for sickle cell anemia? Show your work with a Punnett square. Plese help!!!!
If one parent has sickle cell trait (HbAS) and the other does not carry the sickle haemoglobin at all (HbAA) then none of the children will have sickle cell anaemia. There is a one in two (50%) chance that any given child will get one copy of the HbS gene and therefore have the sickle cell trait.
what is sickle cell anemia ?Sickle cell anemia is a type of hereditary disease provides less oxygen to cells due to a change in the shape of red blood cells, so that it fails to carry oxygen to cells.
The effected or mutated part is the beta gene which is generally makes hemoglobin but due to the mutation in the amino acid, the protein formed is defected and fails to perform its normal function.
To know more about sickle cell anemia, visit
https://brainly.com/question/14511609
#SPJ1
where did it all go wrong
what is difference between MYOCARDIAL INFRACTION and ANGINA PECTORIS ?
Explanation:
myocardial infraction is also known as heart attack and it is the blockage of blood flow to the heart muscles
while
angina pectoris is also known as ischemic chest pain and it is a type of chest pain caused by reduced blood flow into the heart
a species of bird eats insects. the longer its beak, the better it can reach insects in holes in trees. a disease affects the trees in the habitats of the insects. how might this change the frequency of the gene for a long beak?
The long beak gene will become less prevalent. Insect populations may decline or shift to another environment if the illness affects the trees that make up the habitats.
Abiotic or biotic soil?Abiotic—nonliving substances like minerals, water, and air—and biotic—living or once-living organisms like plants and insects—both make up soil. In addition to living and dead plant and animal stuff, soil also contains air, water, and minerals.
Biological soil is which?Biotic Soil Media: What Is It. A synthetic growth medium or designed soil that contains recycled, biodegradable fibres, biostimulants, biological inoculants, and other nutritional additives is known as a biologic soil medium (BSM). It enhances the texture, structure, and natural chemistry of the soil.
To know more about habitats visit:-
https://brainly.com/question/12744358
#SPJ1
Question:
A species of bird eats insects. The longer its beak, the better it can reach insects in holes in trees. A disease affects the trees in the habitats of the insects. How might this change the frequency of the gene for a long beak?
A. The gene for long beaks will mutate.
B. The gene for long beaks will increase.
C. The gene for long beaks will decrease.
D. The gene for long beaks will not change.
PLS HURRY I'LL MARK YOU THE BRAINLEST mark all that apply the action and reaction forces refereed to in newtons third law
Answer:
the last one i think?
How to compare my DNA with the DNA of my best friend?
How would our DNA be similar? How would it be different?
Human DNA is 99.9% identical from person to person. Although 0.1% difference doesn't sound like a lot, it actually represents millions of different locations within the genome where variation can occur, equating to a breathtakingly large number of potentially unique DNA sequences.
hope this helps u :)
What is the term for the site where the muscle attaches that does not move when the muscle contracts?.
The origin is the term for the site where the muscle attaches that does not move when the muscle contracts.
It's simple to believe that muscle is muscle, and that the tissues in hearts, tongues, and arms are essentially the same. Mammalian bodies, however, are composed of three distinct muscle types: cardiac, skeletal, and smooth. Organs including our skin, blood arteries, and digestive tracts are made up of smooth muscles. The heart's muscles are called cardiac muscles. Despite how amazing and sophisticated these tissues are, the skeletal muscles are what carry out the bulk of the work.
The muscles that are a part of the skeletal system are known as skeletal muscles. They are voluntary muscles, as opposed to the hearts and stomachs, and one has cognitive control over them.
learn more about muscle contracts here :
https://brainly.com/question/14907458
#SPJ4
Which climate is a subcategory of temperate marine climates? O arid
O humid subtropical O humid continental O tundra
Answer: Humid subtropical
Explanation: There are three kinds of temperate marine climates: marine west coast, humid subtropical, and mediterranean. Marine west coast climates are the coolest temperate marine climates. Humid ocean air brings cool, rainy summers and mild, rainy winters. Mediterranean climates are drier and warmer.
Answer:
B is your answer
Explanation:
which type of virus is an exception to the central dogma? select all that apply. group of answer choices retrovirus dna virus rna virus
Retroviruses, such as HIV, are an exception to the central dogma as they reverse transcribe their RNA genome into DNA, challenging the flow of genetic information.
The central dogma of molecular biology describes the flow of genetic information from DNA to RNA to protein. While most viruses adhere to this central dogma, there are exceptions. The retrovirus is one such exception.
Retroviruses, like HIV, possess RNA as their genetic material, but they are unique in their ability to reverse transcribe their RNA genome into DNA. This DNA is then integrated into the host cell's genome, where it can be transcribed into RNA and translated into proteins.
This process involves the reverse transcriptase enzyme. Retroviruses essentially reverse the flow of information from RNA to DNA, challenging the central dogma.
In contrast, DNA viruses and RNA viruses generally follow the central dogma, with DNA viruses using DNA as their genetic material and RNA viruses using RNA to directly encode proteins without reverse transcription.
To know more about Retroviruses, refer to the link :
https://brainly.com/question/31713198#
#SPJ11
Which motion describes molecules in a solid at extremely low
temperatures? *
Moving freely and randomly in a space
Vibrating while closely packed together
Sliding around one another and colliding
Bumping together with some room to move
Answer:
vibrating while closely packed together
Explanation:
Your question has been heard loud and clear.
Vibrating while closely packed together is the right answer
In which sentence does the verb agree with the subject?
Several of the readers were searching for books.
Neither of the men were looking in the right place.
Many of the girls plays on the sidewalk.
One of the students type on the computer.
Answer:
all of them except
"Many of the girls plays on the sidewalk."
Explanation:
Subject here "girls" is plural which mean if a subject is plural, its verb must also be plural. verbs REMOVE an s from the singular form.
therefore inorder for it to be correct, s must be remove from play
Answer: Many of the girls plays on the sidewalk.
Explanation: "Plays" needs to be removed. Correct sentence: Many of the girls play on the sidewalk.
Hope this helps! :)
An _______. _______
is an interconnected network for delivering
electricity from suppliers to customers.
Fill in blanks
Answer:
An electrical grid or power grid is an interconnected network for delivering
electricity from suppliers to customers
which of these properties, used alone, would be least useful in identifying most minerals? A color B luster C streak D density
Answer:
A-color
Explanation:
Minerals could have the same color, and you can't depend on color to tell you that.
Answer:
A, color.
Explanation:
Color would be the least useful because minerals are often the same or similar in color. :)
What is one of the main ways that we can help clean up our oceans and help prevent the pollution from getting their
Answer:
Join ocean clean-up efforts and educate people about pollution.
Explanation:
One of the best ways to clean up our oceans is not by actually cleaning them. This sounds counterintuitive but realistically pollution is being added to our oceans faster than we can physically take it out. So what do we do? Education is, if not the best, one of the best ways to change the state of our beaches. By educating a population of people, say even a generation, policies that limit pollution are more likely to be passed with a bigger amount of support.
Don't get me wrong, cleaning up your beaches are great but if you want to make a lasting difference you will have to change the mindset of others, especially the people doing the polluting.
predict the molecular formula of a three carbon alkyne
The molecular formula of a three-carbon alkyne is C₃H₄.
An alkyne is a hydrocarbon compound that contains a triple bond between carbon atoms. The general formula for an alkyne is CₙH₂ₙ₋₂, where "n" represents the number of carbon atoms in the alkyne.
In the case of a three-carbon alkyne, "n" is equal to 3. Substituting this value into the general formula, we get C₃H₂₁₋₂. Simplifying the formula further, we have C₃H₄, which represents the molecular formula of a three-carbon alkyne.
The molecular formula provides information about the composition of a molecule by indicating the number of atoms of each element present. In the case of C₃H₄, it tells us that there are three carbon atoms (C₃) and four hydrogen atoms (H₄).
This arrangement allows for the formation of a triple bond between two of the carbon atoms, with the remaining carbon atom bonded to hydrogen atoms.
For more such answers on alkyne
https://brainly.com/question/31467652
#SPJ8
To what phylum do roundworms belong
Answer:
Nematoda
Explanation: