Answer: C. a molecule that is built using the information stored in a gene
Explanation: A protein is a complex molecule that is made up of amino acids. These amino acids are linked together by peptide bonds to form long chains. Proteins are crucial components of living organisms because they perform a wide range of functions, including structural support, transport, and catalyzing chemical reactions.
Proteins are built using the information stored in genes. Genes are segments of DNA that contain the instructions for building specific proteins. During protein synthesis, the DNA sequence is transcribed into RNA, which then serves as a template for assembling the amino acids in the correct order.
Learn more about proteins here: https://brainly.com/question/19596068.
what are the three basic units or molecules of dna?
The three basic units or molecules of DNA are nucleotides.
DNA (deoxyribonucleic acid) is composed of repeating units called nucleotides. Each nucleotide consists of three main components:
Sugar: DNA nucleotides contain a sugar molecule called deoxyribose. The sugar molecule provides the backbone structure for DNA.
Phosphate: A phosphate group is attached to the sugar molecule in each nucleotide. The phosphate groups form bonds with the sugar molecules of adjacent nucleotides, creating a phosphodiester backbone.
Nitrogenous base: There are four different nitrogenous bases found in DNA nucleotides: adenine (A), cytosine (C), guanine (G), and thymine (T). The sequence of these bases along the DNA molecule encodes the genetic information.
The combination of these three components, sugar, phosphate, and nitrogenous base, forms the basic building blocks of DNA, allowing it to store and transmit genetic information.
To know more DNA, click here.
https://brainly.com/question/30993611
#SPJ4
The three basic units or molecules of DNA are adenine, thymine, and cytosine.
DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions for the development, functioning, growth, and reproduction of all known organisms. It consists of a long chain of nucleotides, which are the basic building blocks of DNA.
There are four types of nucleotides in DNA: adenine (A), thymine (T), cytosine (C), and guanine (G). These nucleotides are connected together through covalent bonds to form a double helix structure.
The sequence of these nucleotides along the DNA molecule determines the genetic code and the characteristics of an organism.
The three basic units or molecules of DNA are adenine, thymine, and cytosine.
Learn more:About basic units of DNA here:
https://brainly.com/question/14812734
#SPJ11
Help ASAP!!! You’ll get brainiest if you do it right!
What is the complementary DNA strand TAC GGC CGT TAT
Answer:
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
I NEED THIS QUICK!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Which compound is a metabolic intermediate of the light-independent reactions in photosynthesis?
ATP
PGA
RuBP
NADPH
Answer:
PGA not sure But Ithink that the correct answer
Explanation:
What is the function of carbon dioxide in the atmosphere?
Answer:
To warm up the Earth.
Explanation:
Carbon dioxide in the atmosphere warms the planet causing climate change.
What goes first with organ ,epithelial tissue ,epithelial cell and organ system
Epithelial tissue lines the organs of the body, including the lungs, heart, and stomach.
Is epithelium an organ system?Epithelium, endothelium, and mesothelium are three types of epithelial cell sheets that line your internal organs, and body space and form the outer layer of your skin. Epithelium generally lines alleyways that are open to the external environment, such as your respiratory area and digestive system.
Glandular epithelial tissue is also established as part of the glands, including hormone-manufacture organs like the liver, pancreas, and spleen. Epithelial tissues are widespread all around the body. They form the covering of all body surfaces.
So we can conclude that Simple epithelial tissues are normally classified by the shape of their cells.
Learn more about epithelial here: https://brainly.com/question/17301113
#SPJ1
what would it take to determine the climate has changed?
Answer:
Sea level rise is another clue that tells us Earth's climate is getting warmer. But melting ice is not the only cause of rising sea levels. As the ocean gets warmer, the water actually expands! Scientists have observed that the sea level has risen 7 inches in the last 100 years.
Explanation:
Because the hotter it get the more water in the ocean the colder less water in the ocean or it could stay the same
The mating calls are ______ diverged in regions of sympatry. Based on this result, one might predict that there has been selection to _______ prezygotic isolation in regions of sympatry, a phenomenon known as _______.
The mating calls are more diverged in regions of sympatry. Based on this result, one might predict that there has been a selection to increase prezygotic isolation in regions of sympatry, a phenomenon known as Reinforcement.
What is Reinforcement?In the process of speciation known as reinforcement, the reproductive isolation (also known as pre-zygotic isolation and post-zygotic isolation) between two populations of a species is increased by natural selection. This happens as a result of selection working to prevent the development of low-fitness hybrid individuals.
To learn more about reinforcement visit:
https://brainly.com/question/12944494
#SPJ4
If you were Henrietta's great-grandchild, and you could go back in time, what would you tell her?
Answer:
Explanation:
What would YOU tell her simple question ask her anything at all like how was life or the family or how she understood life er somthing.
How do substances like CO2 and water move in and out of the cell ?Discuss.
Plz Answe It Guys
Answer:
It is by the process diffusion from the region of concentrated region to low concentrated one.concentration of carbon di-oxide and water is higher in external environment than that inside the cell, CO2and water moves inside the cell.
Explanation:
Please help me with this question
What part of the endocrine system is most likely being affected?
Answer:
i think its
Pituitary Gland<
Explanation:
The endocrine system is the collection of glands that produce hormones that regulate metabolism, growth and development, tissue function, sexual function, reproduction, sleep, and mood, among other things.
Which of the following statements about genes and alleles are true?1. Qualitative traits are each determined by a single gene that has a small number of alleles2. When a gene has 2 alleles, the allele frequency in a population move toward equilibrium values for 0.5 for each allele3. All else being equal, alleles associated with higher reproductive success decrease in frequency4. If the frequency of an allele in a population has changed over generations, then evolution has occured
The true statement about genes and alleles is ( 4 ) ; If the frequency of an allele in a population has changed over generations, then evolution has occurred
Genes are made up of two ( 2 ) alleles, The qualitative or quantitative traits of a human being can not be determined by one gene but by a set of genes. also the frequency of alleles contained in a gene, may move differently and not towards the equilibrium values.
Alleles associated with higher reproductive success do not decrease in frequency rather they increase in frequency through natural selection procedures.
Hence we can conclude that If the frequency of an allele in a population has changed over generations, then evolution has occurred.
Learn more : https://brainly.com/question/9388869
the cell membrane is considered to be selectively permeable, forming a barrier that allows certain substances to pass through but not others. why might this be an important trait for the cell membrane to have?
This might be an important trait for the cell membrane to have Because the cell membrane is selectively permeable, it is able to keep the internal conditions of the cell constant in a changing environment.
Homeostasis is a state of equilibrium that is necessary for all living things. The cell is able to bring in molecules it needs and keep out molecules it doesn't because it is selectively permeable. Additionally, it enables the cell to control when particular molecules enter or exit the cell. Complex signaling cascades that control how cells work are made possible by this.
The structure of the cell membrane makes it selectively permeable. The hydrophobic tails of the phospholipids are facing inward when they are arranged in a bilayer. Because the tails are packed tightly together, no large molecules can pass through.
Know more about cell membrane here: https://brainly.com/question/13524386
#SPJ4
Question 12
If an insecticide reduced the population of grasshoppers , what would happen to the population of shrew ?
A. Increase
B. Decrease
C. Remain the same
D. Run amuck
most blood from the brain flows down the internal jugular veins and then into
Most blood from the brain flows down the internal jugular veins and then into the heart.
This process is essential for the proper functioning of the body. What is the Internal Jugular Vein? The internal jugular vein is a vein in the neck that drains blood from the brain and face. It is one of the primary veins that connect the brain to the rest of the body. When blood is no longer required in the brain, it flows down the internal jugular vein into the heart. Blood flows in veins because of the pressure gradient between different parts of the body. Blood in the veins is under low pressure, so it relies on a system of one-way valves and muscle contractions to move it towards the heart. When the muscle contracts, it pushes blood towards the heart, while the valve prevents blood from flowing backward and keeps it moving forward. This ensures that the blood reaches the heart to be recirculated to the rest of the body. Importance of Blood Flow from Brain to Heart: The process of blood flow from the brain to the heart is crucial for the proper functioning of the body. Blood carries oxygen and nutrients to the brain cells and removes waste products from them. This process ensures that the brain receives an adequate supply of oxygen and nutrients, which is essential for its proper functioning. It also helps in maintaining the blood pressure in the brain, preventing the brain cells from getting damaged.
To know more about , muscle visit
https://brainly.com/question/13920046
#SPJ11
organism a is eukaryotic, unicellular, and lacks a cell wall. organism b is eukaryotic, multicellular, has cell walls, and is autotrophic. in which kingdoms should these organisms be classified?
Kingdom Plantae contains species that are autotrophic and have a cellulose cell wall, whereas kingdom Animalia contains organisms that are heterotrophic and lack a cell wall.
These species be categorized in which kingdoms?Animals belonging to the kingdom Animalia have multicellular bodies, eat in a heterotrophic way, have eukaryotic cells, and lack cell walls. Because they generate their nourishment using solar energy, Kingdom Plantae are autotrophs. Cellulose is a component of plant cell walls.
Most eukaryotes, including animals, do not typically have cell walls, but some do, including fungi, algae, plants, and the majority of prokaryotic creatures.
Which eukaryotic kingdom is multicellular and without a cell wall?The Kingdom Animalia is distinguished from the other groups by having multicellular bodies, a heterotrophic mode of nourishment, eukaryotic cells, and cells without a cell wall.
To know more about eukaryotic visit:-
https://brainly.com/question/23921659
#SPJ4
If a cell has 46 chromosomes and undergoes mitosis, how many chromosomes will the resulting cells have
Answer:
Once mitosis is complete, the cell has two groups of 46 chromosomes, each enclosed with their own nuclear membrane. The cell then splits in two by a process called cytokinesis, creating two clones of the original cell, each with 46 monovalent chromosomes.
Explanation:
why is eukaryotic dna polymerase unable to replace the rna primer of the ""last"" okazaki fragment? why is this not an issue in prokaryotes?
Eukaryotic DNA polymerase is unable to replace the RNA primer of the "last" Okazaki fragment because it requires a free 3' hydroxyl group to add nucleotides. The "last" Okazaki fragment does not have this free 3' hydroxyl group, as it is located at the end of the linear chromosome. This is not an issue in prokaryotes because they have circular chromosomes, so there is no "last" Okazaki fragment.
In eukaryotes, the RNA primer is removed by an enzyme called RNase H, and the resulting gap is filled in by DNA polymerase δ. However, because there is no free 3' hydroxyl group at the end of the linear chromosome, DNA polymerase δ cannot fill in the gap. This results in the shortening of the chromosome with each round of replication, which is known as the end-replication problem.
In prokaryotes, the circular chromosome does not have a "last" Okazaki fragment, so there is no end-replication problem. The RNA primer is removed and the gap is filled in by DNA polymerase III, which can add nucleotides to the free 3' hydroxyl group of the adjacent Okazaki fragment. This allows for complete replication of the prokaryotic chromosome.
Here you can learn more about Okazaki fragment
https://brainly.com/question/29428237#
#SPJ11
What was the name of the scientific research paper you are reading about? a) The Spread of Melanism b) Selection Experiment on Industrial Melanism in the Laptoptera c) Selection Experiments on Industrial Melanism in the Lepidoptera d) The Explanation of Industrial Melanism e) Melanism in the Leopard Laptoptera
The name of the scientific research paper is "Selection Experiments on Industrial Melanism in the Lepidoptera." Option c.
Melanism refers to an organism's congenital overproduction of melanin, which produces dark pigment. Another type of pigmentation, known as pseudomelanism or abundism, is characterized by dark spots or expanded stripes that cover a significant portion of the animal's body and give the impression that it is melanistic. Melanosis is the term for the pathological deposition of black matter, frequently of a malignant nature and leading to pigmented tumors.
The following are the possible choices: a) The Spread of Melanism; b) Selection Experiment on Industrial Melanism in the Laptoptera; c) Selection Experiments on Industrial Melanism in the Lepidoptera. Melanism in the Leopard Laptoptera d) The Explanation of Industrial Melanism e) Melanism. The correct answer is option c, Selection Experiments on Industrial Melanism in the Lepidoptera.
More on scientific research: https://brainly.com/question/32670414
#SPJ11
Which of the following is influenced only by heredity and not environmental factors?
a.
obesity
b.
diabetes
c.
heart disease
d.
muscular dystrophy
Please select the best answer from the choices provided
A
B
C
D
Answer:
D. Muscular Dystrophy
Explanation:
The muscular dystrophies (MD) are a group of inherited genetic conditions that gradually cause the muscles to weaken, leading to an increasing level of disability. MD is a progressive condition, which means it gets worse over time.
 please answer quick and correctly
The rest of teh choices for number 3 is blood and carbon dioxide and for 6 the choices are to transport gases to protect internal organs to control movement or to transport fats
Answer:
Yes, you are right for both.
Vector contact involves contact with __________. a. an infected surface b. contaminated water c. an infected organism d. a carrier organism please select the best answer from the choices provided. a b c d
Vector contact involves contact with an infected organism. Details about vectors can be found below.
What is a vector?A vector is a carrier of a disease-causing agent or pathogen.
This means that a vector must come in contact with an infected organism to carry the disease-causing organism.
An example is the case of mosquitoes, which carries plasmodium pathogen that causes malaria when it feeds on an infected organism.
Therefore, vector contact involves contact with an infected organism.
Learn more about vectors at: https://brainly.com/question/13322477
#SPJ4
GIVING BRAINLIEST ANSWER ASAP
Which form of precipitation would most likely be predicted based on the following information?
Temperature in the clouds = −2 °C (28 °F)
Temperature of the air below the clouds = 2 °C (36 °F)
Season = fall
Rain because, it is the fall season and the temperatures might vary, which means good conditions for rain
Rain because, the temperatures in the cloud and beneath the cloud are below freezing
Sleet because, it is the fall season but it should be the winter season
Sleet because, the temperature in the cloud is below freezing but the temperature beneath the cloud is above freezing
Form of precipitation that would most likely be predicted based on the information : Sleet because the temperature in cloud is below freezing but temperature beneath the cloud is above freezing.
What is meant by precipitation?Liquid or frozen water that forms in the atmosphere and falls to Earth is called precipitation.
When temperature in the clouds is below freezing, water droplets freeze into ice crystals. If air beneath the clouds is also below freezing, these ice crystals will remain frozen and fall to ground as snow. However, if air beneath the clouds is above freezing, ice crystals will partially melt and refreeze into small pellets of ice called sleet before reaching ground.
In this scenario, temperature in the clouds is below freezing, but temperature of the air below the clouds is above freezing, indicating that ice crystals would have time to partially melt and refreeze into sleet before reaching ground.
To know more about precipitation, refer
https://brainly.com/question/25796102
#SPJ1
What is a vector
A quantity that has both mass and speed.
A quantity that has both size and direction. Help asap
Explanation:
As I think Option 2 is the correct one.
Fossil fuels were created from plants and other organisms that lived millions of years ago. Their remains were trapped deep underground.
Ture or False
Answer:
true
Explanation:
plant matter is mostly carbon so the more plant based carbon in a area the greater the chance for a coal deposit animals and reptiles are more liquid based there for they become sludge like oil and natural gas
superior vena cava syndrome is a result of a progressive increase of which process?
superior vena cava syndrome is a result of a progressive increase of thrombosis or external compression
Thrombosis occurs when blood clots block your blood vessels. There are 2 main types of thrombosis: Venous thrombosis is when the blood clot blocks a vein. Veins carry blood from the body back into the heart.
Venous thromboembolism (VTE) is a condition that occurs when a blood clot forms in a vein. VTE includes deep vein thrombosis (DVT) and pulmonary embolism (PE). DVT occurs when a blood clot forms in a deep veins, usually in the lower leg, thigh, or pelvis.
Being sedentary due to bed rest or sitting too long without moving, such as during travel. Family history of blood clots. Having a long-term (indwelling) catheter, a tube in a blood vessel. Obesity.
To know more about obesity visit the link
https://brainly.com/question/22602791
#SPJ11
During a lion and cub moment, Mufasa says to Simba, “Everything you see exists together in a delicate balance…..respect all creatures”. How can this quote be related to the concept of the food web, pyramid of energy, and/or the pyramid of numbers? What could happen if this balance is not respected? Indicate a scene in the movie that is an example of this loss of balance.
Answer:
The quote refrences to the fragility of our enviorment and how that balance is to not be disrupted. That no matter how small,every detail affects that balance and is not to be tampered with. It is the same in the food chain,the elimination of even the smallest of species can have devastating effects on an ecosystem. That is why it is important to preserve resources and respect all life. an example of that balance being disrespected in the movie would be the scene where the once beautiful valley was barren and dry due to the hyenas destroying and using up all of the resources, thus destroying the balance of life and bringing famine to their lands.
Explanation: The circle of life man
When a balance is not respected then it leads to destruction of the whole ecosystem not a single organism.
What is the relation of the quote?This quote is related to the concept of the food web, pyramid of energy, and the pyramid of numbers because every organism is dependent on other organism for its survival. If that organism is eliminated from the ecosystem, then the organism that feeds on it also die.
If this balance is not respected and maintained then the whole ecosystem is destroyed because every organism is dependent on othe organism.
So we can conclude that when a balance is not respected then it leads to destruction of the whole ecosystem not a single organism.
Learn more about balance here: https://brainly.com/question/2261596
In your own words, what is the definition for the word karyotype?
Answer:
Karyotype is defined as the general appearance of chromosomes. An example of karyotype is the size, number and shape of chromosomes in a person's body. noun. The characterization of the chromosomal complement of an individual or a species, including number, form, and size of the chromosomes. noun.
Brainliest question Which equation has the solution x = 9? Select each correct answer.
A) 2x−3=15
B) 4 + 5x = 18
C) 3x + 2 = 25
D) 81x−3=6
E) 24−2x=13
F) x3+7=8
Sorry to put it on biology instead of math, I did not have no answer I think.
Answer:
A should be the correct answer.
The phenolic ______ is present in many consumer products labeled "antibacterial." (a) ethylene oxide (b) formaldehyde (c) hydrogen peroxide
The phenolic compound present in many consumer products labeled "antibacterial" is (b) formaldehyde.
Formaldehyde is commonly used as a disinfectant and preservative in various personal care and household products due to its antimicrobial properties.
It can be found in items such as soaps, shampoos, cleaning agents, and even certain fabrics. Formaldehyde is effective in killing bacteria and preventing their growth, which makes it having antibacterial properties.
However, it's worth noting that formaldehyde can also pose health risks, especially in high concentrations or with prolonged exposure.
To know more about formaldehyde, visit:
https://brainly.com/question/29797593
#SPJ11