which statement is false about how abdominal pain is produced? a. edema and vascular congestion produce abdominal pain by stretching. b. chemical mediators, such as histamine, bradykinin, and serotonin produce abdominal pain. c. low concentrations of anaerobes, such as streptococci, lactobacilli, staphylococci, enterobacteria, and bacteroides, produce abdominal pain. d. ischemia caused by distention of bowel obstruction or mesenteric vessel thrombosis produces abdominal pai

Answers

Answer 1

option c- low concentrations of anaerobes, such as streptococci, lactobacilli, staphylococci, enterobacteria, and Bacteroides, produce abdominal pain. It does not produce pain.

Abdominal pain, also known as a stomachache, is a symptom of both minor and major medical problems. Cramping, achy, dull, intermittent, or sharp abdominal pain can occur. Abdominal pain can occur anywhere on your body between the chest and the groin. The pain could be generalized, localized, or feel like cramps in your stomach. In anaerobic bacteria, low concentration levels of superoxide dismutase, anaerobes and catalase allow oxygen radicals to form and inactivate other bacterial enzyme systems. Gastroenteritis and irritable bowel syndrome are two common causes of abdominal pain. A more serious underlying condition affects about 15% of the population. Abdominal pain is not always caused by a medical condition. Constipation, menstrual cramps,indigestion, overeating, and other factors may contribute to it. Gas due to indigestion, Muscle strain or pull

Learn more about Abdominal Pain here:

https://brainly.com/question/28285800

#SPJ4


Related Questions

Dendrites within interneurons have multiple synapses due to ______

Answers

Answer:

Dendritic tree with many synapses. It is shown that dendrites have extensive connections with the axons in the form of axodendritic synapses, which form an important mode of communication between neurons (see Synapse below and Ch. 6, p. 110).

Explanation:

hope it helps..✌️✌️

Describe the difference between a organism that is a consumer and an organism that is a producer

Answers

Answer:

Consumer: a person or thing that eats or uses something.

Producer: an organism that produces. (makes) its own food.

Explanation:

Hope that helps buddy :)

describe the adaptation of teeth to feeding in herbivorous and canivorous

Answers

Answer:

Most carnivores have long, sharp teeth adapted to ripping, tearing or cutting flesh. While many also possess a few molars in the back of their mouths, and sharp incisors in the front, the most important teeth for carnivores are their long, sharp canine teeth.

Explanation:

its true

How are sedimentary rocks made. A. Magma or lava is cooled B. Materials are pressed together C. Chemical reactions change minerals. D. Earthquakes causes small pieces to fall

Answers

Answer:

B. Materials are pressed together

Explanation:

sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.

Sedimentary rocks are made up by the pressing down together the materials which are loosened through weathering. Thus, the correct option is B.

What are Sedimentary rocks?

Sedimentary rocks are the type of rock which are formed by the accumulation or deposition of mineral particles or organic particles at the Earth's surface, followed by cementation of the particles.

Pieces of rock are loosened by weathering of particles, then these are transported to basin or depression where the sediment is trapped. If the sediment is buried deeply in the basin, it becomes compacted and cemented to form sedimentary rocks. Clastic sedimentary rocks may have particles of rocks ranging in size from microscopic clay to huge boulders.

Therefore, the correct option is B.

Learn more about Sedimentary rocks here:

https://brainly.com/question/10709497

#SPJ5

Maria Jover reports vaginal discharge and discomfort. Dr. King confirms the diagnosis of a yeast infection by performing a smear and identifying the microorganism. Dr. King prescribes over-the-counter vaginal suppositories. After asking Maria if she has any questions, clinical medical assistant Audrey Jones, RMA (AMT) proceeds to help Maria understand the self administration of this particular medication.
The patient, Maria, asks Audrey Jones whether she can use some vaginal suppositories she bought last year. How should Audrey respond?

Answers

Audrey should respond by advising Maria against using the vaginal suppositories she bought last year.

Like other medicines, vaginal suppositories have an expiration date, therefore it's important to utilize them before then. Drug efficacy and safety might deteriorate with time, and suppositories that have beyond their expiration date might not have the desired therapeutic outcome. Because of this, Audrey has to let Maria know that the best suppositories to use are those that were just prescribed for her present yeast infection. It's critical to put the patient's health and well-being first by adhering to the right prescription instructions.

Using suppositories that have expired may not have the therapeutic impact expected and may possibly result in worse-than-ideal outcomes or even negative responses. It's critical to put her health and well-being first by adhering to the recommended dosage and instructions for medications.

To learn more about vaginal suppositories, refer to:
https://brainly.com/question/31076590

#SPJ4

cortical magnification is the _______ of _______devoted to foveal vision.

Answers

Cortical magnification is the amount of cortical area devoted to foveal vision.

Cortical magnification is the disproportionate allocation of cortical area devoted to foveal vision.

In the human visual system, the fovea is a small area in the center of the retina that contains a high concentration of cone cells. It is responsible for detailed central vision.

Cortical magnification refers to the fact that a larger portion of the visual cortex, is the region of the brain responsible for processing visual information. It is dedicated to representing the foveal region compared to the peripheral regions of the visual field.

Learn more about the cortical area, here:

https://brainly.com/question/14643268

#SPJ2

What effect do mechanical and chemical weathering have on the rock at Earth’s surface?

Answers

Answer: Mechanical weathering breaks rocks into smaller pieces without changing their composition. Ice wedging and abrasion are two important processes of mechanical weathering. Chemical weathering breaks down rocks by forming new minerals that are stable at the Earth's surface.

Explanation:

Mechanical weathering, also called physical weathering and disaggregation, causes rocks to crumble. Water, in either liquid or solid form, is often a key agent of mechanical weathering. For instance, liquid water can seep into cracks and crevices in rock. If temperatures drop low enough, the water will freeze.

Answer:

It breaks the rocks into smaller pieces without changing their composition

Explanation:

Numerous different enzymes are produced by the cells.
True
False

Please give explanation thank you :)

Answers

Answer:

True

Explanation:

We can take the example of our digestive system only. Although amylase, lipase, and protease are the major enzymes that our your body utilizes to digest food, there are many other specialized enzymes also contributing to the process.

which event leads to a diploid cell in a life cycle?

Answers

Answer:

Fertilization

Explanation:

HOTS HIGHER ORDER THINKING SKILLS : Think and Answer 1. Roots of pea, bean and gram plants have nodules on them. What is the function of these nodules ? 2. How are the nature of roots and venation in the leaves of a plant related ? 3. Why the banana "tree" is a herb? 4. A small plant has no leaves. It has fibrous roots. What type of venation would it show? ​

Answers

Answer:

A banana tree is a nice tree

I can’t get passed the first box, mind helping me out?

I cant get passed the first box, mind helping me out?

Answers

Vaccine, bacteria, pathogens, cells, toxins, antibiotics. In that order vaccine being first

The theory of endosymbiosis is based onA.evidence from the fossil record B.the knowledge that chloroplasts and mitochondria resemble bacteria C.similarities between chloroplasts and other organelles in animals D.the experiments in which bacteria were grown in plant cells and formed chloroplasts E.the knowledge that ribosomes are structures found in bacteria, plants, and animals

Answers

Endosymbiosis is the theory that mitochondria and chloroplasts originated as independent bacterial cells that were engulfed by another cell and began functioning as organelles within that cell.

Answer: B

5. What are virus hoaxes? Why are the hoaxes sometimes more dangerous than an actual virus?

Answers

Answer:

An actual computer virus is a malicious software, often known as malware, that can harm a computer and its users.

Virus hoaxes are false or misleading information about viruses that circulate through various communication channels.

They can be more dangerous than actual viruses due to their ability to spread quickly, cause panic, and undermine effective public health measures.

Virus hoaxes are deceptive messages or claims that often exaggerate the severity or impact of a particular virus. They can be spread through social media, email chains, or word of mouth. These hoaxes may include misinformation about symptoms, transmission methods, or false remedies, leading people to take ineffective or even harmful actions.

What makes virus hoaxes particularly dangerous is their potential to create panic and misinformation at a rapid pace. The viral nature of social media and other communication platforms allows these hoaxes to reach a wide audience within a short period. As a result, people may make decisions based on false information, such as avoiding necessary medical treatment, taking unnecessary precautions, or spreading fear and misinformation to others.

Moreover, virus hoaxes can undermine public health efforts by diverting attention and resources from legitimate preventive measures. They can erode trust in healthcare authorities and disrupt the dissemination of accurate information, making it harder for individuals to make informed decisions and follow recommended guidelines.

This can have severe consequences, especially during outbreaks or pandemics, where timely and accurate information is crucial for public safety. Therefore, it is essential to verify the credibility of information and rely on trusted sources to mitigate the risks associated with virus hoaxes.

Learn more about viruses :

https://brainly.com/question/29156932

#SPJ11

why is it important that the time between the first and second sample is a short time relative to the life span of the organism

Answers

Answer: A lot could or could have started to happen

Explanation:

It is important that the time between the first and second sample is a short time relative to the life span of the organism because this ensures that the population being studied has not changed significantly over the time period between the two samples.

What is population size?

Population size is the number of individuals in a population. It is a measure of the size of a population and is often used in demography, the study of populations and population changes. Population size can be affected by a variety of factors, including birth rates, death rates, immigration, and emigration. Understanding population size and how it changes over time can help inform policy decisions and help predict future population trends.

If the population has changed significantly, it may be difficult to accurately determine the rate of population growth or decline based on the data. This is because any changes in the population size between the two samples could be due to factors other than the rate of growth or decline. By keeping the time between the samples short, it is more likely that any changes in the population size are due to the rate of growth or decline, rather than other factors. This makes it easier to accurately determine the rate of population growth or decline based on the data.

Learn more about population size, here:

https://brainly.com/question/23433122

#SPJ5

The movement of molecules down a concentration gradient through transport proteins in the cell membrane is a type of

Answers

Answer:

Facilitated Diffusion

Explanation:

Some molecules can move down their concentration gradients by crossing to the lipid portion of the membrane directly,while others must pass through membrane protein s in a process called Facilitated Diffusion

What do you think would happen to the rates of photosynthesis of seagrass and algae if their habitat became muddied when channel clearing caused sediment to stay mixed in with the water?

Answers

Answer:

They would lose their green color

Explanation:

The light doesn't reach them because the mud is blocking it, so they can't preform photosynthesis.

The branch of life sciences that involves the structure and function of the brain and nervous system is called

Answers

The branch of life sciences that involves the structure and function of the brain and nervous system is called Neuroscience.

The nervous system is the primary coordinating system in the human body. It includes the brain and spinal cord, which form the central nervous system, as well as the peripheral nervous system, which consists of sensory neurons and motor neurons.

The study of neuroscience includes examining the cellular and molecular structure of the nervous system, its physiology, and its cognitive functions. It also encompasses research into neurological disorders and the development of treatments for them.

Some subfields of neuroscience include neuroanatomy, neurophysiology, neurochemistry, and neuropsychology.

To know more about neuroscience click on below link :

https://brainly.com/question/30765544#

#SPJ11

HELP HELP
Based on the information in the table, which of the following describes alleles I and IB?
A. The IA and I alleles show sex linkage.
B. The IA allele is recessive to the IB allele.
C. The IA allele is dominant to the IP allele.
D. The 1A and I alleles show codominance.

HELP HELP Based on the information in the table, which of the following describes alleles I and IB?A.

Answers

Answer: The answer is D.) codominance.

HELP HELP Based on the information in the table, which of the following describes alleles I and IB?A.

According to the table IA and IB are showing codominance character. If a person has both IA and IB alleles and has blood group AB, hence option D is correct

What is a blood group?

The blood group is determined by the gene which produces, surface antigens on the red blood cells and antibodies present in the plasma.

In the blood group having i gene does not produce any sugar, while the IA gene produces sugar which results in the A blood group having antibodies against another blood group which is anti-B, and a person having the IB gene produces blood group B and has antibodies anti-A.

If having both IA and IB, it shows codominance, and having blood group AB does not produce any antibodies, while ii produces O blood group and antibodies anti-B and anti-A.

Therefore, IA and IB, show codominance.

Learn more about blood, here:

https://brainly.com/question/29067356

#SPJ2

What type of cells do not go through mitosis?

Answers

Answer: Sperm cells and Egg cells don't go through mitosis.

Explanation:

Answer: Germ cells do not undergo mitosis.

Explanation: hope i helped!

What is the wavelength of a sound wave with a frequency of 9.3 Hz and a wave speed of 3.1 m/s?

Answers

Answer:

What is the wavelength of a sound wave with a frequency of 9.3 Hz and a wave speed of 3.1 m/s?

Explanation:

What is the wavelength of a sound wave with a frequency of 9.3 Hz and a wave speed of 3.1 m/s?

Differentiate between primary and secondary lymphoid organ? Give two examples each for the Granulocyte, Agranulocyte and Fixed leukocytes.
Please answer this immunolgy question with explanation as soon as possible,You will get upvote sure for your proper answer.Thanks for your kind response

Answers

Answer:

Primary lymphoid organs are where lymphocytes are formed and mature. They provide an environment for stem cells to divide and mature into B- and T- cells. There are two primary lymphoid organs: the red bone marrow and the thymus gland.

Secondary lymphoid organs are where mature lymphocytes interact with antigens. They are responsible for the adaptive immune response, which is the body's ability to remember and respond to specific antigens. Examples of secondary lymphoid organs include lymph nodes, the spleen, and the tonsils.

Granulocytes are white blood cells that have granules in their cytoplasm. They are the first line of defense against infection. Neutrophils are the most common type of granulocyte. They are phagocytic, meaning they can engulf and destroy bacteria. Eosinophils are involved in allergic reactions and parasitic infections.

 - Neutrophils: These are the most common type of white blood cell, and they play a major role in fighting infections.

- Eosinophils: These cells help to fight parasites and allergic reactions.

Agranulocytes do not have granules in their cytoplasm. Lymphocytes are a type of agranulocyte that are involved in the adaptive immune response. They can be divided into B cells and T cells. B cells produce antibodies, which are proteins that can bind to and neutralize bacteria and viruses. T cells help to regulate the immune response and kill infected cells.

- Lymphocytes: These cells are involved in the immune system, and they produce antibodies.

- Monocytes: These cells mature into macrophages, which are large cells that engulf and destroy bacteria and other foreign substances.

Fixed leukocytes are white blood cells that are permanently located in tissues. Macrophages are a type of fixed leukocyte that phagocytose foreign particles and debris. Dendritic cells are a type of fixed leukocyte that present antigens to lymphocytes.

- Dendritic cells: These cells are found in the skin and other tissues, and they help to present antigens to lymphocytes.

- Mast cells: These cells are found in the tissues, and they release histamine and other chemicals in response to allergens or other triggers.

somebody help. . can someone please tell me the types of layering in root establishment in plants?.​

Answers

Answer:

Layering can be used to multiply many of your favorite plants now growing around your yard and in your home. There are six common types of layering: air, simple, tip, trench, serpentine and mound. Air and simple layering are the most popular types

Explanation:

PLZ MARK AS BRAINLIEST

Answer:

The answer above me is correct

What percent of the earth surface does the ocean make up

Answers

Answer:

71 percent

Explanation:

Answer:

70%

Explanation:

Both the liver and kidneys are organs of the excretory system. How do the two organs work together to complete a task?

Answers

Answer:

When the liver has broken down due to harmful substances, its by-products are exerted into the bile or blood. Bile by-products enter the intestines and leave your body in the form of feces. Blood by-products are filtered out through the kidneys and leave the body in the form of urine.

Explanation:

When the liver is damaged by harmful substances, their by-products move into the bile or blood, where the by-products of bile enter the intestines and leave your body as feces and by-products of the blood. -products are filtered through the Kidneys and leave the body as urine.

What is Excretion?

Excretion is defined as the process in which metabolic waste is eliminated from an organism, this is done by the lungs, kidneys and skin in vertebrates.

This is in contrast to secretion, where matter may have specific functions after leaving the cell where excretion is an essential process in all forms of life.

Through excretion organisms control osmotic pressure which is defined as the the balance between inorganic ions and water and maintain acid-base balance.

Thus, when the liver is damaged by harmful substances, their by-products move into the bile or blood.

Learn more about Excretion, here:

https://brainly.com/question/14121884

#SPJ6

the blood’s resistance to flow is influenced largely by the __________, which is the percentage of the total blood volume composed of red blood cells.

Answers

The blood's resistance to flow is influenced largely by the hematocrit, which is the percentage of the total blood volume composed of red blood cells.

The volume percentage of red blood cells in blood is determined as part of a blood test and is referred to as the hematocrit. Several other names also know this percentage. The measurement relies on the number of red blood cells and their average size. In most cases, the range for males is between 40.7% and 50.3%, and it ranges between 36.1% and 44.3% for females.

With the advanced technology found in today's laboratories, the hematocrit can either be estimated by an automated analyzer or directly measured, with the method chosen depending on the manufacturer of the analyzer. The calculated hematocrit is obtained by multiplying the total number of red cells by the average volume of each cell.

You can also learn about hematocrit from the following question:

https://brainly.com/question/13739588

#SPJ4

After making observations of the offspring in both Punnett squares, which Punnett square represents a plant reproducing sexually? Support your answer with evidence.

After making observations of the offspring in both Punnett squares, which Punnett square represents a

Answers

actaarlkinge  ou yt know whant doeso iAnswer:no be

yesue s that tritg 3 wa olfolExplanation:1b

Answer:

model A

Explanation:

they reproduce a sexually and they have the same letters both ways

Why are ectomycorrhizal fungi, or EMF, aptly named? a. Their hyphae form tree-like branching structures inside plant cell walls. b. They are mutualistic. c. Their hyphae form dense mats that envelop roots but do not penetrate the cell walls. d. They transfer nitrogen from outside their plant hosts to the interior.

Answers

Their hyphae form dense mats that envelop roots but do not penetrate the cell walls are known as Ectomycorrhizal fungi or EMF aptly.

What are Ectomycorrhizal fungi?

Ectomycorrhizal fungi (EMF) form mutualistic associations with the roots of many tree species. Unlike arbuscular mycorrhizal fungi (AMF), which penetrate the plant root cells, EMF form a dense sheath around the root tips and grow between the cells of the root cortex, forming a mantle or "enveloping" the roots. This mantle is composed of a network of hyphae that do not penetrate the root cell walls, hence the name "ecto-" (meaning outside) mycorrhizal fungi. The hyphae of EMF also form a dense mat or web-like structure in the soil surrounding the root system, which aids in nutrient and water absorption by the plant.

To know more about Ectomycorrhizal fungi, check out: https://brainly.com/question/19351175

#SPJ1

25.
In a monohybrid cross AA aa, how many heterozygotes are found among the F2 offspring?
A)
one
B)
two
C)
three
D)
four
E)
five

Answers

In a monohybrid cross, which is a breeding experiment involving individuals that differ in only one trait, the F1 generation will be heterozygous (Aa) for the trait.

When these F1 individuals are crossed, the resulting F2 generation will exhibit a phenotypic ratio of 3:1 (three with the dominant trait and one with the recessive trait) and a genotypic ratio of 1:2:1 (one homozygous dominant, two heterozygous, and one homozygous recessive). Therefore, in the given monohybrid cross AA aa, all F1 offspring will be Aa. When these Aa individuals are crossed, one-quarter of the F2 offspring will be aa, half will be Aa (heterozygotes), and one-quarter will be AA. Thus, the answer is B) two heterozygotes are found among the F2 offspring. It is important to note that the ratios and probabilities may vary depending on the specific traits and alleles involved in the monohybrid cross.

To know more about heterozygotes refer :

https://brainly.com/question/31553070

#SPJ11

How is RNA different from DNA?
A. DNA is double stranded, contains uracil, sugar is ribose

B. DNA is single stranded , contains thymine , sugar is deoxyribose

C. RNA is single stranded, contains thymine , sugar is ribose.

D. RNA is single stranded , contains uracil , sugar is ribose

Answers

Answer:

D. RNA is single stranded , contains uracil, sugar is ribose

Answer:

D. RNA is single stranded , contains uracil , sugar is ribose

Explanation:

RNA contains the sugar ribose, while DNA contains the slightly different sugar deoxyribose

You discover a new species of insect. You learn that its gamete contain 4 chromosomes each and contain 20 pg of DNA. Given this information, what can you conclude about this organism's somatic cells? a They will contain 4 sister chromatids. b They will contain 40 pg of DNA during GO c They will contain 2 chromosomes during prophase of mitosis. d They will be haploid (2n)

Answers

 options a, b, and c are not accurate conclusions based on the given information.

The correct answer is d) They will be haploid (2n). Gametes are haploid cells, meaning they contain half the number of chromosomes as somatic cells. Since the insect's gamete contains 4 chromosomes, the somatic cells would have a diploid number of 8 chromosomes (2n = 8). The amount of DNA in the gamete is not necessarily indicative of the amount of DNA in the somatic cells, as somatic cells can undergo DNA replication and have varying amounts of DNA depending on the stage of the cell cycle.

to know more about,Gametes visit

https://brainly.com/question/11479681

#SPJ11

Other Questions
Assignment Details:You are assigned an organization as per your term assignment. Your project is to research and analyze that organization and provide your findings.In this assignment, you must submit the Project Plan, Project Status Report to the stakeholders and Project update to the managers.Format : Arial, font 12, single spacedUse the standard cover page and checklist with updateEnsure to mention the group id and all the members of the group who worked in this assignment.Weightage :Project Plan: 5%Project Status Report for Stakeholders: 15%Project Update for Managers: 17%Due date: This is a group assignment and must be uploaded by ONE member from the group in Moodle by 23:59 hrs on Nov 6th, 2021.NOTE:THIS IS THE PLAN, STATUS AND UPDATE OF YOUR PROJECT OF RESEARCHING AND ANALYSING THE ORGANIZATION ASSIGNED AND NOT THE STATUS OR UPDATE OF WHAT THAT ORGANIZATION IS DOING. YOU NEED TO PROVIDE THE UPDATE OF HOW FAR YOU HAVE DONE THIS WORK OF RESEARCHING AND ANALYSING.Project Plan must contain the following: (1 to 2 pages, can use the excel table or any other planning tool)Project Goal and ScopeScheduleTask breakdownRoles and responsibilities of team membersBudget (in terms of time or money)Milestones and measure of success (metrics)Communication Plan and StrategyRisks and mitigations and contingenciesExit criteriaProject Status Report for Stakeholders should contain the details of the following: (1 to 2 pages)Schedule status (indicate if any schedule variance)Budget status (indicate if any cost variance)Schedule and budget projections for the remainder of the projectScope controlStakeholder communication (have the committed reports been shared already?)Quality controlResources (what are the resources you need? Do you have the resources you need or is some resource not available?)RisksProcurements (any external materials purchased? Where are you sourcing your data from for research and analysis?)Project Update for Managers should contain the details as below: (1 to 2 pages, can use GANTT chart or excel for visual representation like graphs)Executive Summary (Current status, whats coming up next immediately, any issues you are facing)Progress against milestones (indicate in percentage how close or far you are from a certain due date or milestone. Can use GANTT chart or graphs to indicate the same.)Key issues (any issues you are currently facing)Proposed actions or steps to resolve for the key issuesNotes: any questions you need to ask the managers or clarification you want to highlight to the managers thoughts? should i redraw this? 4.1.15 Both endogenous T cells and CAR T cells can induce apoptosis of cancer cells by releasing perforins and granzymes. What is the difference in how they recognize their targets?a.CAR T cells can only recognize peptides bound to MHC, while endogenous T cells can recognize a variety of different antigens.b.CAR T cells can recognize both intracellular and extracellular antigens, while endogenous T cells can only recognize extracellular antigens in their native form.c.CAR T cells can recognize a variety of different antigen types, while endogenous T cells can only recognize peptides bound to MHd.CAR T cells can only recognize extracellular antigens, while endogenous T cells can recognize both intracellular and extracellular antigens in their native form. Fill in the blank with the french word that best completes the sentence. Le professeur travaille a Evaluate ab + c for a = 2, b = 3, and c = 4. Using the given DNA segment, design 18-22 bases primers to amplify this whole DNA fragment. Be sure you give the primers sequence in 5'>3. DNA segment: 5' GGTTTCTTCCTACCTCAAGAAGGTAGGATACAACCCTGACAAGATCCCCTTTGTCCC CATCTCTGGTTT 3' A The lifetime in hours of a transistor is a random variable having probability function given by f(x) = cxe*; x0 a) Find c. b) Compute the generating function of X. Hence, calculate E(X*) and write it as an expression of the MacLaurin series. Robel is unsure of how many nights he will stay in Los Angeles.a) Write an equation that will allow Robel to calculate what his total cost will be if he is charged $52 as a one-time fee and the cost per night is $94.b) What will be Robels total cost if he decides to stay 3 nights. Show all your work to justify your answer. Which of the following statements regarding the exclusion of gain on the sale of a principal residence is correct? Multiple Choice a.A taxpayer may not exclude gain if the taxpayer is renting the residence at the time of the sale. b.A taxpayer may simultaneously own two homes that are eligible for the home sale exclusion. c.A taxpayer must be living in a residence at the time it is sold to qualify for the exclusion. d.For a married couple to qualify for the $500,000 exclusion, both spouses must meet the ownership and use tests. When forming online contracts, ____________ is a cyber-technique that preserves electronic data of offer and acceptance without using local hard drives and flash drives.cloud computing If someone was to conduct a study in the field of microeconomics, which of the following questions might they attempt to answer? (There are two correct answers.)-A) What causes the economy to grow over the long term?B) How do people decide whether to work full-time or part-time?C) What determines how many jobs are available in an economy?D) What determines how households and individuals spend their budgets? How does mass affect gravitational force?(5 Points)Gravitational force increases as mass decreases. Gravitational force increases as mass increases.Gravitational force decreases as mass increases. what are the three primary qualities that affect how much heat is needed to change the physical state of an object? multiple select question. mass of the object nature of the object age of the object color of the object starting temperature of the object what did you find most memorable about joan of arcs story ? do you think you could have done what she did ? why or why not ? Which of Hidesatos traits is demonstrated in this excerpt and is characteristic of a folktale? deforestation of japans pine woodlands by the timber industry allowed the matsutake mushroom to grow excessively, to the detriment of other species. Mr. Smith wants a fence with the dimensions of 65ft by 35 ft what is it in meters who was the first head of the national park service? What is the gravitational acceleration Id experience? How does it compare to Earths (for reference, Earths gravitational acceleration is 9.81 m/s2)? i really really need this.. plz answer asap :(( needs to be correct