Which type of process requires a fertilization event in which two haploid gametes unite to create a diploid cell called a zygote?.

Answers

Answer 1

Two haploid gametes must fertilize one another to form a diploid cell termed a zygote during the sexual reproduction process.

What process combines two haploid cells to create a diploid zygote?

In sexual reproduction, gametes, or reproductive (sex) cells, are created by the parents and combine to create an offspring. Haploid cells make up gametes. This indicates that each chromosome is present in one copy in each cell's nucleus. Meiosis, a form of cell division, produces gametes.

Meiosis- It is the process that results in haploid gametes. A type of cell division known as meiosis occurs when the number of chromosomes is cut in half. Only specific types of cells within an organism exhibit it. Homologous chromosomes separate during meiosis, and four haploid cells are created with just one chromosome from each pair.

To know more about meiosis, visit:

https://brainly.com/question/10621150

#SPJ4


Related Questions

Which of the charts below is most likely to represent a saturated solution?
Four bar charts
A. Chart A
B. Chart B
C. Chart C
D. Chart D

Answers

Answer: ”B” if your talking about that chart.

Explanation:

Which of the charts below is most likely to represent a saturated solution?Four bar charts A. Chart A

how can an understanding of osmosis be important in developing methods for the same storage of food?

Answers

Osmosis is also used for preserving fruits and meats, though the process is quite different for the two. In the case of fruit, osmosis is used to dehydrate it, whereas in the preservation of meat, osmosis draws salt into it, thus preventing the intrusion of bacteria.

Emphysema is a disease that damages alveoli describe how this disease would affect a persons ability to breathe then explain how emphysema would affect the concentration of oxygen and carbon dioxide in the bloodstream

Answers

Answer:

Emphysema is one of the lung disorders caused by damage to the air sacs in the lungs, which reduces the body's ability to take advantage of oxygen from the air. This results in inefficient breathing, because it takes extra effort to empty the air from the lungs. This disease progressively destroys the fibers that allow the airways to remain open. This problem causes the collapse of these pathways when a person exhales air. That is, the air that the lungs expel that contains carbon dioxide cannot get out, and consequently, the fresh, oxygen-filled air does not enter the lungs.

Explanation:

When we breathe, the air comes through the bronchial tree to a kind of small sacs called alveoli, which are located at the end of the bronchi and fill the lungs. From the lungs, oxygen is transported, through the arteries, to the different tissues and organs of the body. But, generally due to smoking, people with emphysema have damaged alveoli: the inner walls of these sacs weaken and break, which creates larger air spaces and therefore reduces the air exchange surface of the cells lungs. Consequently, the amount of oxygen that reaches the blood decreases and this can produce in the patient a sensation of shortness of breath, which is the frequent characteristic manifestation of this respiratory pathology. In the pulmonary alveoli, the oxygen in the air is exchanged for carbon dioxide in the blood. The walls of the air sacs are thin and fragile, so the injuries that occur in these air sacs are irreversible. Emphysema causes the alveoli - the small air sacs in the lungs that provide oxygen to the bloodstream - to weaken and they become less elastic. That means the body has difficulty getting enough oxygen or has excess carbon dioxide in the body.

Answer:
My answer is down below. Don't directly copy because you will get plagiarism, and that's not what I want to happen to you. The only reason why I posted my answer is if you are in need of some help to think of things to write. Hope you enjoy it!

Explanation:

One of the sad things about this disease is that we currently do not have a cure for it. Which is very unfortunate for the people that end up getting it. There is some hope of relieving some pain, but there isn't a 100% cure. What emphysema does is it destroys the walls between your alveoli. What happens to your lungs? Well, it makes the lungs less able to absorb oxygen into our bloodstream and also remove carbon dioxide from our blood. The good news/bad news is that if you are diagnosed with emphysema you are likely to still live anywhere from 1-5 more years, which is pretty amazing that our body can last that long with damaged lungs. 

Assume you are looking for microorganisms in a tissue sample from a lung biopsy. The microbes become apparent when you switch to 1000x magnification.
What type of microbe is most likely?

Answers

The type of microbe that is most likely to be found in a tissue sample from a lung biopsy at 1000x magnification is a bacterium.

When a microbiologist is trying to find microorganisms in a tissue sample from a lung biopsy, he/she uses a microscope to examine it.

Because a tissue sample is microscopic in nature, a microscope is required to see the microbes. A bacterium is the most common type of microbe discovered in lung biopsy samples, with other microorganisms such as fungi and viruses also being possible.

Bacteria are classified as prokaryotes and have several distinguishing characteristics. They have a cell wall composed of peptidoglycan, a circular genome, and lack a true nucleus or membrane-bound organelles.In order to observe the microorganisms in the sample, the microbiologist requires magnification.

The magnification needed to detect the microbes is 1000x, as stated in the question. Magnification helps to make tiny structures appear larger and more visible. At 1000x magnification, bacteria and other microorganisms can be observed.

Therefore, the type of microbe that is most likely to be found in a tissue sample from a lung biopsy at 1000x magnification is a bacterium.

To know more about microbe, visit    

https://brainly.com/question/28426314

#SPJ11

How did the oil boom impact higher education in Texas?

Answers

Answer:

When oil came gushing into Texas early in the 20th century, the changes were even more profound. Petroleum began to displace agriculture as the principal engine driving the economy of the state, and Texans' lives were even more drastically affected than they had been by railroads.

Explanation:

Hope it helps!

If not, im sorry I couldn't help :(

I’ll give brainliest!!! Please help

Ill give brainliest!!! Please help

Answers

In this food chain, plankton are the primary producers, which means they convert energy from the sun into organic matter through photosynthesis. The other organisms are consumers, which means they obtain energy by consuming other organisms.

- Plankton (primary producer)

- Moral eel (primary consumer)

- Shark (secondary consumer)

- Orca (tertiary consumer)

The transfer of energy in this food chain can be described as follows:

- Plankton produce organic matter through photosynthesis, converting solar energy into chemical energy.

- Moral eels consume plankton, obtaining the energy stored in their organic matter.

- Sharks consume moral eels, obtaining the energy stored in their organic matter.

- Orcas consume sharks, obtaining the energy stored in their organic matter.

At each level, some energy is lost through metabolic processes such as respiration and digestion, and only a portion of the energy stored in the organic matter is transferred to the next level. This is known as the 10% rule, which states that only 10% of the energy from one level is transferred to the next level.

plankton, moral eel, whale shark, orca

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

please please please please please help me ​

please please please please please help me

Answers

Answer:

i think it is the third option

Explanation:

hope this helped

(sorry if this is wrong.)

The total momentum of the system will remain the same. The momentum and energy is transferred from the first ball into the other one, but none is lost.

Please mark Brainliest! :)

Which of Kepler's laws states that planets travel in an ellipse with the Sun at one focus?​

Answers

Answer:

Kepler's first law

Explanation:

1. Explain the difference between
transcription and translation in DNA.
Make sure you are able to take a DNA
segment and transcribe it and
translate it into mRNA and proteins.

Answers

Transcription is the process by which an RNA molecule is produced from one of the DNA strands whereas translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein.

What is the difference between transcription and translation in DNA?

Transcription is the process by which RNA polymerase enzyme reads the DNA sequence and synthesizes an RNA molecule that is complementary to one of the DNA strands.

During transcription, the DNA double helix is unwound, and the RNA polymerase enzyme adds nucleotides to the growing RNA molecule following the base-pairing rules of A-U and G-C. The resulting RNA molecule is called messenger RNA (mRNA), and it carries the genetic information from DNA to the site of protein synthesis.

Translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein. Translation occurs in the ribosome, where transfer RNA (tRNA) molecules with attached amino acids bind to the mRNA codons in a complementary fashion. This process results in the formation of a polypeptide chain that folds into a functional protein.

To demonstrate these processes, let's take the following DNA segment as an example:

DNA sequence: TACAGCGACGCGTATCGAGG

Transcription:

The first step in transcription is to identify the DNA strand that will serve as the template for the RNA synthesis. In this case, we will use the template strand (the complementary strand to the coding strand).

Template DNA strand: ATGTCGCTGCGCATACTCC

The RNA polymerase enzyme will read this template strand and synthesize a complementary RNA molecule by adding nucleotides to the growing chain. The resulting mRNA molecule will have the same sequence as the coding strand (except for U instead of T).

mRNA sequence: AUGUCGCUGCGCAUACUCCG

Translation:

The mRNA sequence can now be translated into a protein sequence using the genetic code, which is a set of rules that determine how the nucleotide sequence of an mRNA molecule is translated into the amino acid sequence of a protein.

AUG-UCG-CUG-CGC-AUA-CUC-CG

Using the genetic code table, we can determine the amino acid sequence of the protein:

AUG: Methionine

UCG: Serine

CUG: Leucine

CGC: Arginine

AUA: Isoleucine

CUC: Leucine

The resulting protein sequence is: Met-Ser-Leu-Arg-Ile-Leu.

Learn more about transcription and translation at: https://brainly.com/question/11214205

#SPJ1

Indica el período, el grupo y el número atómico de los elementos que se representan con las siguientes configuraciones electrónicas: 1. 1s2 Grupo: ______ Periodo: _______ 2. 1s22s22p63s1 Grupo: ______ Periodo: _______ 3. 1s22s22p63s23p64s2 Grupo: ______ Periodo: _______ 4. 1s22s22p63s23p64s23d1 Grupo: ______ Periodo: _______ 5. 1s22s22p63s23p64s23d104p3 Grupo: ______ Periodo: _______

Answers

Answer:

1. 1s² Grupo: 18  Periodo: 1

2. 1s²2s²2p⁶3s¹ Grupo: 1 Periodo: 3  

3. 1s²2s²2p⁶3s²3p⁶4s² Grupo: 2 Periodo: 4  

4. 1s²2s²2p⁶3s²3p⁶4s²3d¹ (electrones de valencia) Grupo: 3 Periodo: 4

5. 1s²2s²2p⁶3s²3p⁶4s²3d¹⁰4p³ (electrones de valencia) Grupo: 15 Periodo: 4

Explanation:

La configuración electrónica de los elementos es la disposición de todos los electrones de un elemento en niveles y subniveles de energía (orbitales).

Hay 7 niveles de energía, numerados del 1 al 7, y en los que los electrones se distribuyen, lógicamente, en orden según su nivel de energía. Los electrones con menos energía girarán en el nivel 1. Cada nivel se divide en subniveles. Estos subniveles en los que se divide cada nivel pueden ser hasta 4. Estos 4 subniveles se denominan: s, p, d, f. En el subnivel s solo puede haber un máximo de 2 electrones, en p puede haber un máximo de 6 electrones, en el subnivel d 10 electrones y finalmente en el subnivel f puede haber un máximo de 14 electrones.

Por otro lado, los electrones de valencia son los electrones que se encuentran en la última capa electrónica (denominada orbitales de valencia) y tienen muchas posibilidades de participar en una reacción química.

En la tabla periódica, en cada período aparecen los elementos cuyo último nivel de su configuración electrónica coincide con el número del período, mientras que en cada grupo aparecen los elementos que presentan el mismo número de electrones en el último nivel ocupado o capa de valencia. Entonces:

1. 1s² Grupo: 18  Periodo: 1

2. 1s²2s²2p⁶3s¹ Grupo: 1 Periodo: 3  

3. 1s²2s²2p⁶3s²3p⁶4s² Grupo: 2 Periodo: 4  

4. 1s²2s²2p⁶3s²3p⁶4s²3d¹ (electrones de valencia) Grupo: 3 Periodo: 4

5. 1s²2s²2p⁶3s²3p⁶4s²3d¹⁰4p³ (electrones de valencia) Grupo: 15 Periodo: 4

Why are viruses not living??

Answers

Answer:

Viruses are not living cause they need any host (body or living organism) To perform its function.

Explanation:

Answer:

Viruses are not living things. Viruses are complicated assemblies of molecules, including proteins, nucleic acids, lipids, and carbohydrates, but on their own way they can do nothing until they entered a living cell. Without cells viruses will not be able to multiply. Therefore viruses ante not living things.

Suppose you encountered a location with the following dominant species: Wintergreen, Yellow Birch, and a species of tall tree that you were unable to identify. What successionaryy stage is the location? How do you know?

Answers

Answer: The succsessionary stage is low because the tree is low in terms of population. The tree is not even identified, that is how low it's population is. Hope this helps!

The successionary stage is the seral stage because there are dominant species like wintergreen, yellow birch, and a species of tall trees observed.

What do you mean by Succession?

Succession may be defined as the gradual and continuous replacement of one community by another community over a specific period of time.

The bare area of the successionary stage deal with no existence of any species, while the pioneer stage of the sucessionary stage deals with the presence of small grasses, shrubs, etc.

The seral stage of the successionary stage involves the existence of species of tall trees, yellow birch, and wintergreen.

Therefore, the successionary stage is the seral stage because there are dominant species like wintergreen, yellow birch, and a species of tall trees observed.

To learn more about the successionary stages, refer to the link:

https://brainly.com/question/13420649

#SPJ2

explain human digestive system​

Answers

Answer:

The human digestive system consists of the gastrointestinal tract plus the accessory organs of digestion.

Digestion involves the breakdown of food into smaller and smaller components, until they can be absorbed and assimilated into the body. 

explain human digestive system

This questions has two parts
35 points

This questions has two parts 35 points

Answers

Part A

Answer: (A) Candida Albicans and Saccharomyces Cerevisiae

Explanation: They have the smallest difference in Cytochrome C

Part B

Answer: (B) The two species have high molecular homology

Explanation: Molecular homology means resemblances between species on the molecular level. Since the two species from the answer in Part A have the smallest difference in Cytochrome C it means they have high molecular similarities; this is due to evolving from the same common ancestor.

(A) is not the right answer because the fungi in the table might all look similar but have different or similar genetic blueprints.(C) is not the right answer because fungi can reproduce sexually or asexually, so reproduction cannot help with determining relatedness.(D) is not the right answer because if the two species from the answer in Part A are closely related because they are both fungi, the answer for Part A should be all of the options.

The blood does all of the things below except one. Which one does the
a. Carries oxygen to all the cells
b. Delivers glucose to all the body's cells.
c. Break down food
d. Helps the body to fight disease with white blood cells

Answers

Answer:

C break down food.

Explanation:

The blood does carry oxygen and delivers glucose. It also helps fight disease with white blood cells

so the only option left is C. Break down food; which the digestive system does.

Match the type of adaptation to the correct example

Match the type of adaptation to the correct example

Answers

Answer:

hope this helps you! :)

Match the type of adaptation to the correct example

Answers:

a

Explanation:

Wells
A. Lane B
B. Lane D
C. Lane C
D. Lane A
80 70 60 40
。 |||
|
c| | || |
I
80%
Electrodes
Agarose Gel
A
25 10 5
||
||
Lane (D) of Known
fragment sizes.
Kilobase pairs
Chamber filled with
Unknown DNA size samples buffer solution

Answers

By comparing the migration distances of the unknown DNA samples in Lane D with the known fragment sizes in Lane D, it is possible to estimate the size of the unknown DNA fragments.

In the given information, a DNA agarose gel electrophoresis setup is described. The gel contains wells labeled A, B, C, D, and E, and lanes are represented by letters A, B, C, and D. The numbers 80, 70, 60, and 40 indicate the known fragment sizes (in kilobase pairs) in Lane D.

The gel is filled with a buffer solution, and the Lane D contains the unknown DNA samples.To analyze the unknown DNA samples, the gel electrophoresis process is conducted. DNA samples are loaded into the wells of the gel, and an electric current is applied.

The negatively charged DNA fragments move through the gel towards the positively charged electrode. The smaller fragments migrate faster, while the larger fragments move more slowly.

If the unknown DNA fragments migrate to positions that align with the known fragment sizes, it suggests a similarity in size between the unknown fragments and the known fragments. This information can be useful for determining the approximate size of the unknown DNA samples.

For more such questions on DNA

https://brainly.com/question/28282298

#SPJ8

In your textbook, read about chemical bonds.
Complete the table below by writing the type or types of chemical bond found in the type of matter
on the left. Use the following types of chemical bonds: covalent, ionic, metallic.
Matter
Type of Chemical Bond Present
13. Molecule
14. Hydrogen gas (H2)
15. Magnesium oxide (Mgo)
16. Metal
17. Table salt (NaCl)
18. Sodium monoxide (Na,0)
19. Water

In your textbook, read about chemical bonds.Complete the table below by writing the type or types of

Answers

Answer:

13.covalent,14.covalent bond 15.ionic 16 metallic 17.ionic bond 18.ionic 19. Covalent

.What will happen to the concentration of lactate if a human muscle cell runs out of oxygen?
A.) It is impossible to predict what will happen to the concentration of lactate.
B.) Lactate levels will increase.
C.) Lactate levels will decrease.
D.) Lactate levels will not change.

Answers

B.) Lactate levels will increase if a human muscle cell runs out of oxygen. This is because in the absence of oxygen, the muscle cell shifts to anaerobic respiration to generate energy.

Anaerobic respiration produces lactate as a byproduct, which accumulates in the muscle cell. As lactate builds up, it lowers the pH of the cell, leading to muscle fatigue and discomfort. This process is known as lactic acidosis. The accumulation of lactate in the bloodstream can also lead to systemic effects, such as nausea and dizziness. Therefore, it is important to maintain adequate oxygen levels during exercise to prevent the buildup of lactate and associated negative effects on the body.

Learn more about respiration here:

https://brainly.com/question/18024346

#SPJ11

what formulae do we use when calculating the number of organisms using capture recapture method. Some help I will give you brainliest​

Answers

Answer:

Use the information on capture recapture method to calculate the total number of organisms in habitat.

First capture : 200

Second capture : 120

Number of organisms with second capture =40. The number of of organisms therefore is 600

Explanation:

Hope this helps u

how an atom change if all of its electrons are removed

Answers

Answer:

If all the electrons of an atom are removed, it will change to become a positively charged ion called a cation. Additionally, the loss of all of its electrons means there is no negative charge to balance the positive charges of the protons.

Explanation:

What information can be gained from knowing the alpha (impact) angle of a blood stain? Assume that the bloodstains all resulted from an single impact source.A) Point-of-convergenceB) Point-of-transferC) Point-of-viewD) Point-of-evidence

Answers

Knowing the alpha (impact) angle of a blood stain can provide information on the point-of-convergence. The correct alternative is option A.

The alpha angle is the angle between the long axis of a bloodstain and a line perpendicular to the surface on which the bloodstain has landed.

This angle is useful in determining the direction from which the blood droplet originated and can provide important information about the point of convergence, which is the location in three-dimensional space where the blood spatter originated.

By analyzing the alpha angle of multiple bloodstains in a crime scene, forensic investigators can determine the direction of the blood droplets' travel, and subsequently the location of the point of convergence.

The point of convergence is the point at which the lines of travel of multiple blood droplets intersect in three-dimensional space, and is typically an important area to investigate as it can provide important information about the location and movement of the victim and perpetrator during the crime.

In addition to the point of convergence, the alpha angle can also provide information about the type of weapon or object that was used to produce the bloodstain.

For example, a high-velocity impact angle (i.e. small alpha angle) can indicate a gunshot, while a low-velocity impact angle (i.e. large alpha angle) can indicate a blunt force impact, such as from a baseball bat or a hammer.

So, the correct alternative is option A.

To know more about Alpha impact angle here:

https://brainly.com/question/29036150#

#SPJ11

HELPPPPP
i forgot how to do this

HELPPPPPi forgot how to do this

Answers

Answer:

purple flowers is controlled by a recessive allele.

Explanation:

Plants are classified based on the presence of a certain specialized tissue. a specialized tissue called_____tissue helps transport_____and water to all parts of the plant.

Answers

Answer:

Plants are classified based on the presence of a certain specialized tissue. A specialized tissue called xylem tissue helps transport water and dissolved minerals to all parts of the plant.

Explanation:

Xylem is a complex tissue in plants that is responsible for the transportation of water and dissolved minerals from the roots to the leaves and other parts of the plant. It is composed of several different cell types, including tracheary elements and parenchyma cells. The tracheary elements have thick walls and are dead at maturity, they are responsible for the transportation of water and dissolved minerals. The parenchyma cells support the tracheary elements and also store food.

Xylem is one of the two types of transport tissue in plants, the other one is called phloem, which is responsible for the transportation of sugars and other organic compounds throughout the plant.

Answer:

blood

Explanation:

oxygen with food and nutrients

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Answers

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

Answer:

Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.

Explanation:

the pleasure center of the brain is located in the

Answers

The pleasure center of the brain is located in the nucleus accumbens.

The nucleus accumbens is a region located deep within the brain, specifically in the basal ganglia, which is involved in reward and pleasure processing. It is part of the brain's reward pathway and plays a crucial role in mediating the experience of pleasure, motivation, and reinforcement. The nucleus accumbens receives input from various brain regions, including the prefrontal cortex and the hippocampus, and integrates this information to regulate feelings of pleasure and reward.

When an individual engages in pleasurable activities such as eating delicious food or engaging in enjoyable activities, the nucleus accumbens is activated, releasing dopamine, a neurotransmitter associated with reward and pleasure. This activation of the pleasure center reinforces the behavior and motivates the individual to seek out similar pleasurable experiences in the future.

In summary, the nucleus accumbens serves as the pleasure center of the brain, playing a vital role in the experience of pleasure and reward.

learn more about nucleus accumbens here:

https://brainly.com/question/29560022

#SPJ11

Which of the following structures of a virus is made up of protein?
O Capsid
O Tail
O Sheath
O Plug

Answers

Tail bc it’s the correct one

The pedigree below traces the inheritance of alkaptonuria, a biochemical disorder. Affected individuals, indicated here by the colored circles and squares, are unable to metabolize a substance called alkapton, which colors the urine and stains body tissues.

Answers

Wish you a GREAT Thanksgiving :)

The pedigree below traces the inheritance of alkaptonuria, a biochemical disorder. Affected individuals,

you have just eaten a candy bar and your blood glucose levels are rising. this will activate which organ of the endocrine system?

Answers

As blood sugar levels rise, the pancreas produces insulin, a hormone that prompts cells to absorb blood sugar for energy or storage.

the pancreas the principle function of the pancreas is to preserve healthful blood sugar tiers. it is a large gland located in the back of the stomach. It produces insulin, glucagon, and different hormones. Diabetes occurs while the pancreas does not produce sufficient insulin or whilst the body does no longer use insulin properly (known as insulin resistance).

Glucagon is a hormone that your pancreas makes to help alter your blood glucose (sugar) ranges. Glucagon increases your blood sugar degree and forestalls it from losing too low, whereas insulin, every other hormone, decreases blood sugar levels.

The prevailing idea is that the overconsumption of high-fat and high-sugar foods reasons adjustments in muscle, fat, and liver cells that leads to a faded response from the pancreatic hormone insulin.

To know more about insulin click here

https://brainly.com/question/786474

#SPJ4

Other Questions
What happens to valence electrons in ionic bonding? Find an equation of the tangent plane for z " x sinpx ` yq at p1, 1q Luca coria 4 millas cada maana antes de ir a trabajar. no trabaja los domingos cuntas millas corria Luca en una semana?A.7B.12C.24D.28 one reason that gains iq and achievement test scores from attending head start quickly dissolve is that many of the children what does it reveal about the origins and status of migrants to british north american colonies from 170017 How are the 2013 food waste challenge objectivessimilar to those in the basic recycling slogan:Reduce, Reuse, Recycle? the opening paragraph of a solicited proposal should contain all of the following except ________. a cube with side lengths s has a volume of 64 cubic units. what is the length of the side of the cube? Which precedent was set by George Washington during his presidency?a) He wore civilian clothes and never acted as though he were royalty.b) He dressed in his general's uniform and chose former officers as advisers.c) He served three terms as president and made all decisions alone.d) He lived in the White House and created the nation's first political party. by 2019, what percentage of district judges in texas were women? simplify and write in usual form ((5.5 * 10 ^ - 4)(6 * 10 ^ 7))/((3.3 * 10 ^ - 6) * (2 * 10 ^ 4) ^ 2) 7. Which is not a sedimentary rock?A basaltBcalcitegypsumDhalite benny has argued for a long time for a new national park in montana, but you really shouldn't listen to him. benny owns a general store in the proposed vicinity, and if the park is created, he stands to profit handsomely from the flow of visitors. group of answer choices no fallacy. argument against the person, abusive. appeal to ignorance. appeal to unqualified authority. argument against the person, circumstantial. What is the coefficient in this expression 2 + m/4 PLS HELP 100 POINTSWashington's Farewell AddressWhich TWO of the following best state the central ideas of the text?1.Washington declines a third term in order to set presidential precedent.2.Above all else, complete and total patriotism in Washington's view, unites the people.3.Washington warns against partisan fighting, afraid it will incite animosity and become a detriment to democratic governance4.Washington advocates for the complete separation of church and state.5.Wary of partiality and being caught up in other countries' fights, Washington promotes neutrality in foreign matters. 6.7.5. While you sleep, your body is using energy at a rate of 77 W. How many food calories are used during an eight hour period Explainhow all four cueing systems (Thephonological, The syntactic, The semantic, and The pragmatic) worktogether to help a person speak, listen, read, and write. Include aBRIEF description of Exhaust hoses should be used because one of the exhaust gasses can be deadly in high concentrations. this gas is ________. What did the 14th and 15th Amendment do for African American?. Identify three regions added to the Ottoman Empire by Suleiman the Magnificent: