Which types of objects tend to lose their electric charge more quickly?

Answers

Answer 1

The object gains or loses electrons, it becomes charged and creates an electric field around it. The ability of an object to hold onto its electric charge is known as its electrical conductivity. Some objects are good conductors of electricity, while others are poor conductors, also known as insulators.

The ability of an object to hold onto its electric charge depends on the material of the object. Generally, materials like metals, which have free electrons, tend to lose their electric charge more quickly as compared to insulators like rubber or plastic. Metals have free electrons that can easily move from one atom to another, which means that they can conduct electricity easily. On the other hand, insulators like rubber or plastic have electrons that are tightly bound to their atoms, which means that they cannot conduct electricity easily. As a result, they hold onto their electric charge for a longer time and do not lose it quickly. In summary, objects made of metals tend to lose their electric charge more quickly as compared to insulators like rubber or plastic. However, it is important to note that the electrical conductivity of an object also depends on various factors like humidity, temperature, and surface area, among others.

learn more about electric here.

https://brainly.com/question/8971780

#SPJ11


Related Questions

A cup of coffee with cooling constant k = -0.09 is placed in a room temperature of 18°C. If the coffee is served at 93 °C, how long will it take to reach a drinking temperature of 73 °C?

Answers

The time taken for the coffee to cool from 93°C to 73°C is approximately 36.1 minutes.

The cooling law is given by:

$$\frac{dQ}{dt}=-k(T-T_0)$$

where Q is the heat in the object, t is the time taken, T is the temperature of the object at time t, T0 is the temperature of the environment and k is a constant known as the cooling constant.

We need to find the time it takes for the coffee to reach a drinking temperature of 73°C given that its initial temperature is 93°C.

Therefore, we need to find the time it takes for the coffee to cool down from 93°C to 73°C when placed in a room temperature of 18°C.

Let’s assume that the heat energy that is lost by the coffee is equal to the heat energy gained by the environment. We can express this as:

dQ = - dQ where dQ is the heat energy gained by the environment.

We can substitute dQ with C(T-T0) where C is the specific heat capacity of the object.

We can rearrange the equation as follows:

$$-\frac{dQ}{dt}=k(T-T_0)$$

$$-\frac{d}{dt}C(T-T_0)=k(T-T_0)$$

$$\frac{d}{dt}T=-k(T-T_0)$$

The differential equation above can be solved using separation of variables as follows:

$$\frac{d}{dt}\ln(T-T_0)=-k$$

$$\ln(T-T_0)=-kt+c_1$$

$$T-T_0=e^{-kt+c_1}$$

$$T=T_0+Ce^{-kt}$$

where C = e^(c1).

We can now use the values given to find the specific value of C which is the temperature difference when t=0, that is, the temperature difference between the initial temperature of the coffee and the room temperature.

$$T=T_0+Ce^{-kt}$$

$$73=18+C\cdot e^{-0.09t}$$

$$55=C\cdot e^{-0.09t}$$

$$C=55e^{0.09t}$$

$$T=18+55e^{0.09t}$$

We can now solve for the value of t when T=93 as follows:

$$93=18+55e^{0.09t}$$

$$e^{0.09t}=\frac{93-18}{55}$$

$$e^{0.09t}=1.3636$$

$$t=\frac{\ln(1.3636)}{0.09}$$

Using a calculator, we can find that the time taken for the coffee to cool from 93°C to 73°C is approximately 36.1 minutes.

For more such questions on time, click on:

https://brainly.com/question/26046491

#SPJ8

Forces affect motions in living and nonliving things. In a human, swallowed food moves down the esophagus into the stomach, even if the human is upside down doing a handstand. Which force moves food through the esophagus into the stomach?

Forces affect motions in living and nonliving things. In a human, swallowed food moves down the esophagus

Answers

Answer:

figured it out its d the last one

Food is moved through the esophagus by the push force created by esophageal contractions. Option D is the right response as a result.

What is the second law of Newton?

The resultant force exerted on an object is proportional to the rate of change of momentum, according to Newton's Second Law.

Food is forced into the stomach by the constriction of the esophagus during the process of traveling down it.

As food travels down the esophagus, it is driven into the stomach by the narrowing of the esophagus.

                                                                                                                             

Option D is the right response as a result.

Learn more about Newton's second law here, refer to the link;

brainly.com/question/13447525

#SPJ6

In heather's physics class, she had to solve the equation 7=12at2+ut for u. Which equation correctly solves for u?.

Answers

In heather's physics class, she had to solve the equation 7=12at2+ut for u. The correct answer is B.

A formula known as an equation uses the equals sign to express how two expressions are equal. Finding the values of the variables that result in the equality is the first step in solving an equation with variables.

The unknown variables are also known as the variables for which the equation must be solved, and the unknown variable values that fulfill the equality are known as the equation's solutions.

The equation 7 = 1/2 at² + ut can be solved as follows:

7 = 1/2 at² + ut

First we can subtract 1/2 at² from each side

7 -1/2 at² =  1/2 at² + ut - 1/2 at²

7 -1/2 at² = ut

Then we must divide by t

(7 -1/2 at²)/t = ut/t

Then we can solve it

(7 -1/2 at²)/t = u

Your question is incomplete the missing option attached below

Learn more about equation at https://brainly.com/question/9183973

#SPJ4

In heather's physics class, she had to solve the equation 7=12at2+ut for u. Which equation correctly

Carbon dioxide is removed from Earth's atmosphere by

animal respiration.

decaying organisms.

plant photosynthesis.

burning fossil fuels.

Answers

Carbon dioxide is removed from Earth's atmosphere by plant photosynthesis. The correct option is C.

Plant photosynthesis is the process by which plants use light energy to convert carbon dioxide and water into glucose and oxygen. This process is essential for the production of food and oxygen in the atmosphere.

Animal respiration (option A) releases carbon dioxide into the atmosphere, contributing to an increase in atmospheric carbon dioxide levels.

Decaying organisms (option B) also release carbon dioxide into the atmosphere as part of the natural carbon cycle, but they do not remove carbon dioxide from the atmosphere.

Burning fossil fuels (option D) releases large amounts of carbon dioxide into the atmosphere, contributing to the increase in atmospheric carbon dioxide levels.

Plant photosynthesis (option C), on the other hand, removes carbon dioxide from the atmosphere as plants use carbon dioxide during the process of photosynthesis to produce carbohydrates and release oxygen.

Therefore, Plant photosynthesis is the only option that correctly identifies a process that removes carbon dioxide from the atmosphere.

To learn more about photosynthesis click:

https://brainly.com/question/18060934

#SPJ1

Which planet do most known extrasolar planets most resemble?
O A. Jupiter
O B. Mercury
O C. Mars
O D. Pluto

Answers

Answer:

the correct answer is jupiter

Answer:

planet Jupiter

Explanation:

Most of the extrasolar planets that have been discovered are most like the planet Jupiter in our solar system

Explain what ionisation is and why it is dangerous

Answers

Ionisation: the loss or gain of an electron

It is dangerous because cells that have been ionised can either die, or can mutate incorrectly, which might cause cancer.

Water is considered to be

Answers

Answer: the thing that brings you life- h2o- idrk the question but if this helps your welcome ^-^have a good day

Explanation:

8. Identify the color process (RGB or CMYK) used in each step. taking a photograph with a digital camera the image appears on a computer monitor printing the image using a laser printer d. seeing the image on the paper with your eyes C. a. b.​

Answers

The fundamental distinction is that RGB is used for electronic displays (cameras and monitors), whereas CMYK is used for printing. Many clients generate or alter their print-ready designs with design apps that employ the RGB colour mode.

What is the role of RGB in photography?

It refers to the use of red, blue, and green LEDs in diverse combinations to generate varied light colours. RGB LEDs can intelligently alter colour saturation and hue immediately at the source, ensuring correct colour balance between LED lights, cameras, and existing or ambient light for natural-looking results.

The four ink plates used in certain colour printing are referred to as CMYK: cyan, magenta, yellow, and key (black). The CMYK model masks colours partially or completely.

learn more about CMYK

https://brainly.com/question/29454996

#SPJ1

A car traveling in a straight line has a velocity
of 3.58 m/s at some instant. After 6.72 s, its
velocity is 11.9 m/s.
What is its average acceleration in this time
interval?
Answer in units of m/s

.

Answers

Answer: 1.2381 m/s

Explanation:

vf=vi + at

11.9 = 3.58 + a(6.72)

8.32 = a(6.72)

1.2381 m/s = a

The magnetic field in the figure is decreasing at the rate 0.3 T/s. (Figure 1) Part E What is the magnitude of the acceleration of a proton at rest at point c? Part F 2.0 cm What is the direction of the acceleration of a proton at rest at point c? upward horizontally to the left downward horizontally to the right a=0 Part G What is the magnitude of the acceleration of a proton at rest at point d?

Answers

The acceleration of a proton at rest at point d is indicated by the magnitude of the magnetic field in the image, which is decreasing at a rate of 0.3 up and 2.0 cm down and a=0 horizontally to the right. Part G

What is magnetic field?

The area where the force that magnetism acts around with a magnetic material or even a moving electric charge is known as the magnetic field. Moving electric charges plus magnetic dipoles combine to form a magnetic field, which acts as a force field on other adjacent moving charges & magnetic dipoles. Magnetic compass needles as well as other permanent magnets align in the direction of magnetic fields like the one found on Earth. Electrically charged particles are moved in a helical or circular pattern by magnetic fields.

What is magnetic field made of?

Electric charges in motion create magnetic fields. Every object is made of atoms, and each atom has an electron-orbiting nucleus made up of protons and neutrons. Because the orbiting electrons have minuscule moving charges, each atom generates a very weak magnetic field.

To know more about Magnetic Field visit

https://brainly.com/question/23096032

#SPJ4

A single stranded sequence of a gene is shown below. An investigator wants to amplify and isolate this small gene using PCR. Design two PCR primers, each 15 nucleotides long, that can be used to amplify this DNA segment. (remember that DNA sequences are written 5' to 3' by convention) ACTTTCCAAACGCCCCGTGTCGATACTGAACGAATCGATGCACGCTCCC TTCCTTGAAAACGCATAAACATACAAGTGGGCAGATGATGCGTACGCCC CTCTAATACATCCAACACTCTACGCCCTCTTCAAGAGCTGGAAGGGCA CCCTGCACTTGGATAGGGGATTATCTCGTAAGGCAAGCTCGTACCGTC ATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGGATAGTTTCGAA CCTCGGTTACTAGTCCTAATAAGGGAACGCTGTCTGAAGGATGAGTGT CAGCCAGTGTA Forward Primer Reverse Primer

Answers

The forward primer for PCR amplification of the given gene sequence is 5'-ACTTTCCAAACGCCC-3', and the reverse primer is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.

To design the PCR primers for amplifying the given gene sequence, we need to identify regions that flank the target segment. The primers should be complementary to the template DNA and positioned in such a way that DNA synthesis occurs in the desired direction.

Based on the provided gene sequence, the forward primer is designed to bind to the coding (sense) strand of DNA. It starts at position 1 (5'-end) and extends for 15 nucleotides. The forward primer sequence is 5'-ACTTTCCAAACGCCC-3'.

The reverse primer, on the other hand, is designed to bind to the non-coding (antisense) strand of DNA. It starts at a position near the end of the gene sequence (position 241) and extends for 15 nucleotides in the opposite direction. The reverse primer sequence is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.

These primers will anneal to their complementary sequences on the template DNA during the PCR amplification process. The resulting amplicon will span the target gene segment and can be subsequently isolated and studied further.

To learn more about amplification click here brainly.com/question/30300512

#SPJ11

assume an inductor is connected to a 180-v ac line and the inductor has an induced voltage of 120 v. how many volts are there to push current through the wire resistance of the coil?

Answers

Assuming an inductor is connected to a 180-v ac line and the inductor has an induced voltage of 120 v, there are 60 volts available to push the current through the wire resistance of the coil.

To determine the voltage that pushes the current through the wire resistance of the coil, you'll need to consider the voltage across the inductor and the applied voltage from the AC line. Given that the induced voltage across the inductor is 120 V and the AC line voltage is 180 V, you can calculate the voltage across the wire resistance by using the formula:

Voltage across wire resistance = AC line voltage - Induced voltage across the inductor

Voltage across wire resistance = 180 V - 120 V = 60 V

So, there are 60 volts available to push the current through the wire resistance of the coil.

More on voltage: https://brainly.com/question/29009908

#SPJ11

FILL THE BLANK.
the energy density of most enteral formulas is between _____.

Answers

The energy density of most enteral formulas is between 1.0 and 2.0 kilocalories per milliliter (kcal/mL).

The energy density of enteral formulas refers to the amount of calories (energy) contained within a given volume of the formula. Enteral formulas are specially designed liquid nutrition products used for individuals who are unable to consume food orally or have difficulty absorbing nutrients from solid food.

The energy density of most enteral formulas typically falls within the range of 1.0 to 2.0 kilocalories per milliliter (kcal/mL). This range allows for flexibility in meeting individual energy needs based on factors such as age, medical condition, and nutritional requirements.

Enteral formulas with lower energy density, such as 1.0 kcal/mL, are often used for individuals who require a lower calorie intake or have specific dietary restrictions. These formulas may be recommended for those with certain gastrointestinal disorders or conditions where a slower rate of nutrient delivery is desired.

On the other hand, enteral formulas with higher energy density, such as 1.5 or 2.0 kcal/mL, are utilized when higher calorie requirements need to be met within a smaller volume. These formulas may be beneficial for individuals with increased energy needs, such as those recovering from surgery, trauma, or severe malnutrition.

It's important to note that the energy density of enteral formulas can vary among different brands and types of products. Additionally, the choice of an enteral formula and its energy density should be made under the guidance of a healthcare professional or registered dietitian, considering the specific nutritional needs of the individual.

Hence, The energy density of most enteral formulas is between 1.0 and 2.0 kilocalories per milliliter (kcal/mL).

To know more about energy density here

https://brainly.com/question/26283417

#SPJ4

A imple pendulum ha a period of 3 econd. If the value of ‘g’ i taken a 9. 98 m-2 calculate the length of the pendulum

Answers

Answer:

T (Period) = 2 π (L / g)^1/2         for a simple pendulum

L = g * T^2 / (4 π^2)

L = 9.98 m/s^2 * 9 s^2 / 39.5 = 2.27 m

what is a crystalline solid?​

Answers

Answer:

A crystal or crystalline solid is a solid material whose constituents are arranged in a highly ordered microscopic structure, forming a crystal lattice that extends in all directions

Explanation:

your welcome

by which method does the structure at b release neurotransmitter?

Answers

Answer:

The influx of Ca2+ triggers the release of neurotransmitters stored in synaptic vesicles (B) by exocytosis.

hope this helps.

Which is not a force?
O momentum
O friction
O pull
O weight​

Answers

Answer:

weight

Explanation:

the reason is because I am invteble

Weight because forces can use themselves

How much energy does it take to boil water for pasta? For a one-pound box of pastayou would need four quarts of water, which requires 15.8 kJ of energy for every degreeCelsius (°C) of temperature increase. Your thermometer measures the startingtemperature as 48°F. Water boils at 212°F.a. How many degrees Fahrenheit (°F) must you raise the temperature?b. How many degrees Celsius (°C) must you raise the temperature?c. How much energy is required to heat the f

Answers

The thermometer measures the starting temperature as,

\(T_1=48^{\circ}F\)

The temperature required for the boiling the water is

\(T_2=212^{\circ}F\)

(a). The temperature requires to boil is,

\(\begin{gathered} T=T_2-T_1 \\ T=212-48 \\ T=164\text{ F} \end{gathered}\)

Un zapato de golf tiene 10 tacos cada uno con un área de 0.0 pulgadas en contacto con el piso suponga que al caminar hay un instante en que los tacos soportan el peso completo de una persona de 180 libras ¿cuál es la presión ejercida por los tacos sobre el suelo?

Answers

Pregunta completa :

Un zapato de golf tiene 10 tacos cada uno con un área de 0.01 pulgadas en contacto con el piso suponga que al caminar hay un instante en que los tacos soportan el peso completo de una persona de 180 libras ¿cuál es la presión ejercida por los tacos sobre el suelo?

Responder:

12230825.435 pascal

Explicación:

Dado que:

Peso (W) = 180 libras

Número de tacos = 10

Área por montante = 0.01 in²

Área total (10 * 0.01) = 0.1 pulg²

Usando la calculadora de conversión:

180 libras = 81.647 kg

0.1 pulg² = 6.452 × 10 ^ -5 m²

Recordar :

Presión = Fuerza (Newton) / Área (m²)

Fuerza = masa * aceleración debida a la gravedad

Aceleración por gravedad = 9,8 m / s²

Presión = (81.647 * 9.8) / (6.452 * 10 ^ -5)

Presión = 800.1406 / 6.452 * 10 ^ -5

Presión = 12230825.435 pascal

An engine of 50Kg pumped water through a vertical height of 4m in 10s. Calculate the power of the pump(10 meters per second)​

Answers

The power of the pump is calculated by dividing the work done by the time taken. In this case, the pump does 1960 Joules of work in 10 seconds, which results in a power of 196 Watts. The power of the pump is 1960 Watts.

We can calculate the power of the pump using the formula:
Power = Work done / Time taken. First, we need to calculate the work done by the pump. Work done is equal to the force applied multiplied by the distance traveled in the direction of the force. In this case, the force applied by the pump is the weight of the water being pumped, which is equal to the mass of the water (we'll assume it's 50 kg for simplicity) multiplied by the acceleration due to gravity (9.81 m/s^2). So, the force applied by the pump is:
Force = 50 kg x 9.81 m/s^2
     = 490.5 N

First, we need to calculate the work done. Work done is given by the formula:
Work = mass × gravity × height
where mass = 50 kg, gravity = 9.8 m/s² (approx.), and height = 4 m.
Plug in the values into the formula:
Work = 50 kg × 9.8 m/s² × 4 m = 1960 Joules
Now, we need to calculate the power of the pump. Power is given by the formula:
Power = Work / Time
where Work = 1960 Joules and Time = 10 s.
Plug in the values into the formula:
Power = 1960 Joules / 10 s = 196 Watts
To know more about Joules visit:

https://brainly.com/question/18596314

#SPJ11

An object i dropped from ret and fall freely 20. Meter to Earth. When i the peed of the object 9. 8 meter per econd?

Answers

Answer:

The speed of the object is 9.8 meters per second after one second of free fall.  In that one second, the object travels 4.9m.

Explanation:

On Earth, acceleration due to gravity is 9.8\(\frac{m}{s^2}\).  Use kinematic equation #1 to find the time it takes this object to achieve the given speed (v).

\(v=v_0+at\\a=9.8\frac{m}{s^2}\\v_0=0\frac{m}{2}\\v=9.8\frac{m}{s}\\9.8\frac{m}{s}=0.0\frac{m}{s}+(9.8\frac{m}{s^2})t\\t=\frac{9.8\frac{m}{s}}{9.8{m}{s^2}}\\t=1 s\)

This is intuitive.  The velocity of an object in free fall gains 9.8\(\frac{m}{s}\) per second unless acted upon by an outside force.

To find how far the object has fallen, insert the given and derived values into kinematic equation #2.

\(\Delta y=(\frac{v+v_0}{2})t\\\Delta y=(\frac{9.8\frac{m}{s}+0.0\frac{m}{s}}{2})(1 s)\\\Delta y=4.9m\)

Hope that helps.

an evacuated tube uses an accelerating voltage of 35 kv to accelerate electrons to hit a copper plate and produce x-rays. non-relativistically, what would be the maximum speed of these electrons before hitting the copper plate?

Answers

The maximum speed of the electrons before hitting the copper plate would be 1.5 x 10⁷ m/s.

The maximum speed of non-relativistic electrons can be calculated using the formula for the kinetic energy (K) of a particle, which is given by

K = (1/2)mv²,

where m is the mass of the electron and v is its velocity. In this case, the electrons are accelerated by a voltage of 35 kV.

To calculate the maximum speed, we can equate the electric potential energy gained by the electrons to their kinetic energy. The electric potential energy is given by the product of the charge of the electron (e) and the accelerating voltage (V), so we have

eV = (1/2)mv².

Solving for v, we find v = √((2eV)/m), where e is the elementary charge and m is the mass of the electron. Substituting the given values (e = 1.6 x 10⁻¹⁹ C, V = 35,000 V, m = 9.11 x 10⁻³¹ kg), we can calculate the maximum speed of the electrons to be approximately 1.5 x 10⁷ m/s.

To learn more about maximum speed, here

https://brainly.com/question/10236290

#SPJ4

2. A disturbance that generates a wave may be a simple pulse or shock.
b. False
a.
True

Answers

That's true.

-- a bell starts ringing (wave) when you tap it (simple pulse)

-- a pond starts rippling (wave) when a stone drops in (simple shock)

-- a guitar strings starts waving when you pluck it

Un movil avanza a 20 m/s y recorre una distancia de 800 km. Determinar el tiempo en horas que utiliza

Answers

Answer:

t = 11.1 hours

Explanation:

The question says that, "A mobile advances at 20 m / s and travels a distance of 800 km. Determine the time in hours you use".

Given that,

Speed of a mobile, v = 20 m/s = 72 km/h

Distance, d = 800 km

We know that,

Speed = distance/time

So,

\(t=\dfrac{d}{v}\\\\t=\dfrac{800}{72}\\\\t=11.1\ h\)

So, it will take 11.1 hours.

A wave's speed changes when it goes through a different medium, or type of matter. Our atmosphere is one type of medium, and is crucial to helping sunlight sustain life on Earth. Explain how the atmosphere does this, and what life on Earth might be like if we didn't have an atmosphere.

Answers

Effect on temperature.

If there were no atmosphere around the earth, the temperature of the earth will increase during day and decrease during night. In the absence of atmosphere around the earth, it will be like a moon. There would be no life, no winds, no rains, no fires, no protection against harmful solar radiations. Due to absence of atmosphere around the moon, the temperature ranges from -1900C to 1100C. Air is a bad conductor of heat. The atmosphere has an average temperature of the earth almost steady during the day and night. It prevents sudden increase in temperature during the day time. Also, it decreases the rate of escape of heat during night time.

The speed of light in water is 230Mm/s. Suppose an electron is moving through water at 250 Mm/s . Does that violate the principle of relativity? Explain.

Answers

It does not violate the principle of  relativity because the speed of the electron in water can explained as its relative speed with water.

What is principle of  relativity?

The principle of relativity states that there is no physical way to differentiate between a body moving at a constant speed and an immobile body.

If the speed of light in water is 230Mm/s and an electron is moving through water at 250 Mm/s, it does not violate the principle of  relativity because the speed of the electron in water can explained as its relative speed with water.

Learn more about principle of  relativity here: https://brainly.com/question/1419696

#SPJ1

What is the relationship between the mass of an object and the distance the object slides off the end of the ramp?

2. What is the relationship between the angle of the ramp and the distance the object slides off the end of the ramp?

3. What is the relationship between gravity and the distance an object slides and the distance the object slides off the end of the ramp?

4. What is the relationship between the coefficient of static frictions and the distance the object slides off the end of the ramp?

5. What is the relationship between the coefficient of kinetic friction and the distance the object slides off the end of the ramp?

Answers

The relationship between gravity and the distance an object slides and the distance the object slides off the end of the ramp is as follow:

1. The relationship between the mass of an object and the distance the object slides off the end of the ramp is that the heavier the object is, the more friction it has on the ramp, and so it will slide a shorter distance.

2. The relationship between the angle of the ramp and the distance the object slides off the end of the ramp is that the steeper the ramp is, the greater the force of gravity acting on the object, and so it will slide a longer distance.

3. The relationship between gravity and the distance an object slides off the end of the ramp is that the greater the force of gravity acting on the object, the longer the distance it will slide off the end of the ramp.

4. The relationship between the coefficient of static friction and the distance the object slides off the end of the ramp is that the greater the coefficient of static friction, the greater the friction force, and so the object will slide a shorter distance.

5. The relationship between the coefficient of kinetic friction and the distance the object slides off the end of the ramp is that the greater the coefficient of kinetic friction, the greater the friction force, and so the object will slide a shorter distance.

To know more about gravity visit:

https://brainly.com/question/557206

#SPJ11

When the white ball strikes the other colored balls, what can you say about the total momentum of all of the balls combined?

When the white ball strikes the other colored balls, what can you say about the total momentum of all

Answers

Momentum is never created or destroyed. It is conserved.

The cue stick gave the cue ball all the momentum there is on the table.  There's nothing on the table that can pour in any more momentum.

After the strike, with 15 or 16 balls rolling every which way around the table, the total momentum of all of them combined will be the same as the cue ball's momentum right now, before the strike.

A 50 kg student holding a 7 kg backpack rides a 4 kg skateboard down the sidewalk at 3 m/s. What is the total momentum of the student, backpack, and skateboard?

Answers

Answer:

183 MLT^-1

Explanation:

Mass = 50kg +7kg +4kg =61 kg

Velocity = 3m/s

Momentum = mass × velocity

\(p =61\times 3\\\\p =183MLT^-^1\)

Answer:

Mass= 61 kg. Success to The homework.

A jet play sits on the runway and then rapidly accelerates does it go to potential to kinetic energy?

Answers

kinetic energy because it's moving
Other Questions
jack has $7.55 of change in his pocket. if he has 4 more dimes than than nickels, and twice as many quarters as nickels, how many of each coin does jack have each year the mccormick hardware store places one order for riding lawn mowers in february. the selling season is april-august. the following probability distribution of demand is assumed by mccormick: demand probability 0 10% 1 15% 2 30% 3 20% 4 15% 5 10% the lawn mowers are purchased by mccormick from the wholesaler at $3,000 per unit and sold for $4,250 per unit. mccormick anticipates being able to liquidate surplus ( 1) _____ (national/state)2) _____ (national/state)3) _____ (landowners/ wealthy, educated)4) _____ (landowners/ wealthy, educated)5) _____ (agriculture/ manufacturing)6) _____ (agricu1. Fill in the blanks.< e Hamilton and The Federalists e Strong 1) government e Ruling power given to Government should promote 7) interpretation of the Constitution Protective tariffs protect 9) Jeff the desired rate of return uses compound interest because . multiple choice question. compounding is required by federal law it assumes all cash inflows are reinvested at the same rate it is easier than using simple interest compound interest is more accurate What are the main advantages of using a random forest versus a single decision tree?. The formal charge on sulfur in (so4)2- is___. where the lewis structure of the ion is: A. 0 B.-2 C.-4 D.2 On the first day of spring, an enire field of flowering trees blossoms. The population of locusts consuming these flowers rapidly increases as the trees blossom. The relationship between the elapsed time, t, in days, since the beginning of spring, and the total number of locusts, Nday (t), is modeled by the following function: Nday (t) = 300.(1.2)^tComplete the following sentence about the weekly rate of change in the locust population. Round your answer to two decimal places. Every week, the number of locusts grows by a factor of Thomas needs at least 8 apples to make an apple pie. he has 3 apples. if x represents the number of apples thomas still needs, which inequality can be used to represent the situation? why is my iphone not sending text messages to one person? ent3. The Johnson family has a busy weekend. They haveto drive 352.8 miles to Aunt May's wedding in Georgiaand then they must continue 88.5 miles to make it tocousin Sam's graduation. What is the total distancethe Johnson family will travel one way on this trip?DX18 -onng+eser5. Mark seta goalto bike 100 miles in one week What hardware components are generally required for a desktop computing system? The quotient of c and six is eight what is the value of x Help me!!!!!!!!!!!!!!!!! No absurd answers and links allowed. Wont report if u tried to help! A ____ is the structure that contains the DNA of the cell. Centriole?Chromosome?Cytoplasma?Vacuole? Which of the following is true of a quasi-experiment?Group of answer choicesWe can balance participant variables between groups in a quasi-experiment.In a quasi-experiment, the researcher assigns participants to conditions based on the particpants preexisting level of the independent variable.In a quasi-experiment, the researcher randomly assigns participants to groups.A quasi-experiment allows us to infer causality more accurately. romare bearden was influenced by which of the following: question 9 options: persian pottery african masks egyptian wall painting native american textiles Given the principle of isostasy, what is the requirement for uplifting landmasses and form tall mountainous regions? O The mountains must have roots of anomalously thick mantle, made of rocks that are very dense The rocks that form the mountains must be denser than average continental crust The mountains must be disected by strike-slip faults The mountains must have roots of thickened continental crust made of rocks that are of relatively low density Iron combines with 5 g of Copper (1) Nitrate to form 6.01 g of Iron (1) Nitrate and 0.4 g of coppermetal. How much Iron was required to complete this reaction? A small amount of chemical splashes in Franks eye. What should Frank do immediately? hemophilia is a hereditary genetic disorder that impairs the body's ability to control blood clotting or coagulation. this trait is associated with the x chromosome and is recessive in nature. if a heterozygous woman and a man with hemophilia have children, what is the probability of their sons having the disorder?