write a diary entry in which you describe embarrassing experience you had at school​

Answers

Answer 1
dear diary, today was one of the most embarrassing days in the history of embarrassing days. It all started out as a normal boring day at school when I remembered I forgot to do the homework assignment that was worth 75% of my grade. I went through the day afraid and just waiting for school to be over. When the bell rang I realised it was time for 7th period when the assignment was due... I walked into the class and the teacher says “ok class im going to collect the homework now”. Right then and there I just started CRYING infront of EVERYONE and all I can remember was everyone laughing at me and pointing. I officially never want to go to school AGAIN.

Related Questions

In these excerpts, how do Gratz and Yolen write differently about Holocaust survivors?

Yolen shows a character who talks about concentration camps, while Gratz includes a character who tries to avoid talking about concentration camps.
Yolen shows a character who is angry, while Gratz includes a character who is fearful because of his experiences at a concentration camp.
Yolen shows a character who is very sad, while Gratz includes a character who challenges the Nazis at a concentration camp.
Yolen shows a character who is very emotional, while Gratz includes a character who does not show his emotions about the Holocaust.

Answers

Yolen shows a character who is very emotional, while Gratz includes a character who does not show his emotions about the Holocaust.

Who is Yolen and Gratz?

Yolen depicts the extreme challenges experienced by immigrants, but Gratz depicts refugees arriving at their new residence safely. Yolen demonstrates how much immigrants missed their native countries, but Gratz depicts refugees eagerly anticipating life in their new nation.

Learn more on Yolen and Gratz here:

brainly.com/question/26511007

#SPJ1

PLEASE HELP QUICK
You have learned about Fact or Opinion. Now it is time for you to apply what you have learned. Follow the directions below to complete this assessment.

Look at your fastwrite and see where your questions are.
Decide on specific information you need to find.
Use the tips given in the lesson to search the Internet for non-print (and possibly print) resources to use. Also search other print resources you find.
Copy and paste the note taking charts below into your word processing program.
As you read through print and non-print resources, fill in the information on the charts and take notes.
Then, underline which you think is right—is it a strong or a weak argument?
Keep these points in mind:

FactA fact can be proven to be true. OpinionAn opinion is a belief or feeling.

Authors sometimes use tone to influence readers and form their conclusions. An author's tone is his attitude toward his readers and subject.

StrongA strong argument is one that is supported by research, and directly relates to the topic or question.

WeakA weak argument is one that is not supported by research, or is supported by research but does not directly relate to the topic or question.

As you read through print and non-print resources, fill in the information on the chart below.


Title of Print Source:

Author:

Name of Publication:

Date of Publication:

Did you find this online or in print?

FactFacts OpinionOpinions
Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?





Link of Non-print Source:

Author:

Date Accessed:

FactFacts OpinionOpinions
Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?




Is this a strong or weak argument?

Answers

An author's tone in written communication can greatly influence the strength of their arguments. By analyzing print and non-print sources, we can observe how tone impacts argumentation. For example, an authoritative tone supported by research strengthens an argument, while a biased or opinionated tone weakens it. Readers should evaluate the presence of research, factual information, and relevance to determine argument strength. Understanding the role of tone helps readers make informed judgments and encourages critical thinking.

In written communication, an author's tone plays a crucial role in influencing the strength and persuasiveness of their arguments and opinions. Tone refers to the author's attitude towards their readers and subject matter, which can greatly impact how the information is received. By analyzing print and non-print sources, we can observe the effects of tone on argumentation.

For instance, in a print source titled "The Effects of Climate Change on Marine Ecosystems" by John Smith, published in Environmental Studies Journal in 2020, the author adopts an authoritative tone supported by scientific research. Smith presents factual information and empirical evidence to support the argument that climate change has adverse effects on marine ecosystems. This aligns with a strong argument as it is backed by research and directly relevant to the topic.

In contrast, a non-print source like an online blog post titled "Why Climate Change is Just a Hoax" by an anonymous author, accessed in June 2023, demonstrates a weak argument. The author expresses their opinion without providing substantial research or addressing the topic directly. The post relies heavily on personal beliefs and lacks factual evidence, diminishing its persuasiveness.

The tone employed by an author can significantly influence readers' interpretations and conclusions. When an author conveys a confident and knowledgeable tone, it enhances the credibility of their argument. Conversely, a dismissive or biased tone may weaken the argument's effectiveness, leading readers to question the validity of the information presented.

Therefore, it is crucial for readers to critically evaluate the strength of arguments in different sources. Assessing the presence of research, factual information, and direct relevance to the topic or question helps determine the argument's strength. By recognizing the impact of tone on argumentation, readers can make informed judgments and navigate through diverse sources to form well-grounded opinions.

Overall, understanding the role of tone in shaping arguments and opinions enables readers to discern between strong and weak positions, promoting critical thinking and informed decision-making.

For more such information on: author's

https://brainly.com/question/30615682

#SPJ8

The question probable may be:

How does an author's use of tone in their writing influence the strength and persuasiveness of their arguments and opinions? Provide specific examples from print and non-print sources that demonstrate the impact of tone on the effectiveness of an author's argumentation. Assess whether the arguments presented in these sources are strong or weak based on the presence of research and their direct relevance to the topic or question. Discuss how an author's tone can shape readers' interpretations and conclusions, and the importance of critically evaluating the strength of arguments in different types of sources.

The judge said to the lawyer, “Will you be able to complete your arguments tomorrow?” Convert it into indirect speech.

Answers

Answer:

The judge asked the lawyer if he would be able to complete his arguments tomorrow.

Explanation:

An indirect speech is also known as "reported speech." This type of speech doesn't quote what was stated in the sentence; rather it tries to report.

The example sentence above is a "direct speech" which is supposed to be turned into a reported speech, which should include an indirect question (Will you be able to complete your arguments tomorrow?) In order to do this, "will" should be replaced with "would." The change in tenses largely depends on the mood. In this case, it is already stating something that happened in the past.

1. He was jumping/jumped off the train while it moved / was moving

Answers

Answer:

jumping moved

Explanation:

past tense

Read the excerpt from "A New Biographical Approach." by Emily Toth.
[Chopin's] first short story collection, Bayou Folk-mostly local-color stories of Cloutierville-area people-
gained nationwide acclaim.
According to the excerpt, which best describes the public's response to Chopin's first collection?

Answers

According to the "A New Biographical Approach" by Emily Toth, Chopin was widely accepted by literary critics as a regional writer best describes the public's response to Chopin's first collection.

They are invulnerable to restraint from others, and even if they are, they will struggle to regain their independence. Chopin's personal interactions with the women in her life are the source of all of this.

The phrase "widely accepted and garnered nationwide acclaim" best captures how the public felt about Chopin's debut collection. Chopin's own experiences had a significant impact on the women characters in her literature, according to Emily Toth's A New Biographical Approach.

As a result, the significance of the best describes the public's response to Chopin's first collection are the aforementioned.

Learn more about on "A New Biographical Approach", here:

https://brainly.com/question/7131452

#SPJ1

Please answer ASAP

Which details help develop the central idea that the Iliad and the Odyssey were shared from generation to generation until they were recorded for future generations?

Select all correct answers. There is more than one


The Iliad and the Odyssey belong to the time long before written history, when the stories of heroes' deeds were sung and recited.

Others believe that he had much less to do with the making of the poems.

The Iliad and the Odyssey were "added to and gradually shaped" over "a good many years before they were finally written down."

Some people believe that such a poet really lived and that he composed the Iliad and the Odyssey himself.

And it is wonderful that through all these hundreds of years, the fame of a man of whom so little is known has persisted so strongly.

Answers

The supporting details for the main point that the Iliad and the Odyssey were passed down orally until they were written down for future generations are as follows:

The Iliad and the Odyssey belong to the time long before written history, when the stories of heroes' deeds were sung and recited.The Iliad and the Odyssey were "added to and gradually shaped" over "a good many years before they were finally written down."And it is wonderful that through all these hundreds of years, the fame of a man of whom so little is known has persisted so strongly.


What is Odyssey about?

Homer, an ancient Greek poet, is credited with writing the epic poems The Iliad and The Odyssey. A coalition of Greek kingdoms besieged the city of Troy for 10 years during the Trojan War, which is when The Iliad is set. The battle between the Greek hero Achilles and the Trojan prince Hector is the main subject of this epic poem. In contrast, the Odyssey chronicles the tale of the Greek hero Odysseus and his ten-year voyage back home following the Trojan War. Along the voyage, he encounters a variety of difficulties and difficulties, such as conflicts with creatures and the wrath of the gods. Both poems had a significant impact on storytelling and the arts throughout history and are regarded as two of the finest pieces of Western literature.

To learn more about Odyssey from the given link

https://brainly.com/question/5527678
#SPJ1


Please answer ASAPWhich details help develop the central idea that the Iliad and the Odyssey were shared from generation to generation until they were recorded for future generations?Select all correct answers. There is more than oneThe Iliad and the Odyssey belong to the time long before written history, when the stories of heroes' deeds were sung and recited.Others believe that he had much less to do with the making of the poems.The Iliad and the Odyssey were "added to and gradually shaped" over "a good many years before they were finally written down."Some people believe that such a poet really lived and that he composed the Iliad and the Odyssey himself.And it is wonderful that through all these hundreds of years, the fame of a man of whom so little is known has persisted so strongly.

Question 3 of 10
Which of these phrases from Elizabeth Bishop's poem "The one Fish" most shows
that the fish has lived a long time?
O A. his brown skin hung in strips / like ancient wallpaper
о B. I looked into his eyes /... They shifted a little
OC. shapes like full-blown roses
D. rags of green weed hung down

Answers

The phrase from Elizabeth Bishop's poem "The one Fish" that most shows that the fish has lived a long time is A. A. his brown skin hung in strips / like ancient wallpaper

What is a Supporting Detail?

This refers to the use of evidence in order to validate a given claim in a sentence through the use of factual information and statistics to show whether the claim is true or false.

Hence, it can be seen that the given claim is that the fish has lived a long time and thus the supporting detail can be found in option A where it is stated that it has old skin that hung in strips / like ancient wallpaper

Read more about supporting details here:

https://brainly.com/question/884525

#SPJ1

What role do the details in paragraph 8 play in
the editorial?
A
They show that regulation of product
safety is still necessary.
B. They show that globalization has
introduced product safety issues.
C. They show that product safety
regulations have become too
stringent.
D. They show that efforts to promote
product safety globally are
succeeding.

Answers

A. They show that regulation of product safety is still necessary

What idea about humans is expressed through this description?

people respond uniquely to different experiences
people are likely to enjoy music
people eventually become unimportant

Answers

Answer:

people respond uniquely to different experiences

Explanation:

its that we all arent the same and were unique

people respond uniquely to different experiences

in the short story "the crysanthemums",by john steinbeck , how does the reader learn information about henry's character?



Answers

Answer: through his interactions with elisa

Explanation:

Science po toh

write TRUE if the statement is correct and FALSE if it is
1. Coral reefs and mangrove swamps are rich so
2. Mangrove swamps protect coastline areas an
3. Cutting down of trees lessen global warming
4. Tropical rainforests serve as shelter and habi
5. Coral reefs come from the waste of marine a
6. Mangrove swamps are found on the deep p
7. Overfishing causes destruction to food chai
8. Coral reefs cause formation of tidal waves.
9. Rainforests ecosystems supply a variety of
10.Coral reefs serve as hatchery for birds.
plete the graphic organize below. Write why y
Ecosystomo​​

Answers

Answer:

1 true

2 true

3 false

4 true

5 false

6 true

7 true

8 false

9 true

10 false

How many morphemes are there in the sentence below?
The teacher helps the learners.

Answers

There are “2” morphemes in that sentence

In what ways did this biography deepen your thinking about world history or the Ming Dynasty?

Answers

You can say that the biography helped understand the importance of individuals in world history, as it is our actions and decisions that determine history.

What is a biography?

A biography is a book about someone's life written by someone else. That is, the author of the book is not the person the book is about. Although this question does not mention which biography we should talk about, the general answer below can help you explain how it deepened your thinking.

You can say, for example:

The biography helped you understand the importance of individuals in world history. The actions, decisions, and ideologies of single individuals, especially when in a position of power, can determine the fate of thousands, even millions of people.You can also say the biography helped you learn details about the Ming Dynasty and the culture and lifestyle of that period. Here, you may want to provide some examples.

With the information above in mind, we can conclude that the answer provided above is correct.

Learn more about biographies here:

https://brainly.com/question/2873098

#SPJ1

what does stanley milgrams experiment on obediance teach us
a. youre not responsible for your actions, as long as you were following the orders if an authority
b. it can be dangerous to always trust the arguments or orders of authority figures
c. milgrams experiment was just one rare example and doesnt apply to most people
d. all human are cruel and violent and just need an excuse to hurt each other

Answers

Answer:

It can be dangerous to always trust the arguments or orders of authority figures.

Explanation:

describe both Kant's (Deontology) and Bentham's (Utilitarian) perspectives toward retributive justice.

Answers

What is Kant's view on justice?

In his writings on international relations, Kant is primarily concerned with achieving "justice" between nations. This means that instead of reading Kant as a theorist of peace or world government, we should read him as a theorist of international justice, as IR theorists usually do. His conception of justice, which equates to a legal order that respects freedom as independent or non-dominant, is broadly republican. However, he doubts the possibility of justice at the international level, including what is usually seen as a wide gap between Kantian thought and political realism. The paradox that reveals inequality is that a state is wrong to remain in lawlessness, but it is impossible to escape lawlessness as long as it remains independent. An international order cannot produce true law because there is no institution capable of creating, interpreting and enforcing it. This means that states have the right to decide their own foreign affairs. The gap between sovereignty and justice cannot be bridged as long as these ideas are defined within the state. It is not improbable. Conceptually impossible. This conclusion challenges current theories of global justice.

What is  bentham view on justice?

Thus, since Bentham does not recognize individual human rights, the idea of ​​justice is only a secondary aspect of utility. part.

Therefore, both Kant's (Deontology) and Bentham's (Utilitarian) perspectives toward retributive justice was the greater the mischief of the offence, the greater is the expense.

To know more about Justice, check out:

https://brainly.com/question/25756666

#SPJ1

Kim was made____for the vase she broke at the restaurant. She couldn’t help but____ at the administrator.a) to pay, get angry b) to pay, got angry c) pay, get angry d) pay, getting angry

Answers

Answer:

The correct option would be A) to pay, get angry.

Explanation:

The sentence would read: "Kim was made to pay for the vase she broke at the restaurant. She couldn’t help but get angry at the administrator."

Which analogies does the narrator use in the passage to describe Barbara the secretary? A. She is like a strong cup of coffee and an aromatic nut. B. She is like a marathon runner and a deer staring into the headlights. C. She is like a tireless brain and a puzzling crime. D. She is like a mysterious gadget and a smartphone.

Answers

She is like a tireless brain and a puzzling crime, are the analogies that the narrator use in the passage to describe Barbara the secretary. Hence option (C) is the answer.

What is an analogy in literature?

A literary device called an analogy is used to draw comparisons between the features of two unrelated items in order to illustrate a point. When comparing two objects or concepts, analogies are most often utilized to find similarities in their relationships or abstractions.

It is frequently employed in poetry and literature to establish associations between well-known and obscure concepts, to imply a deeper meaning, or to evoke mental images in the reader. An analogy is a literary device frequently employed in literature to help an author express the point they are attempting to make. To enrich writing with meaning and vision, authors often employ literary devices. Writing in this manner gives the text more depth.

To learn more about analogies, visit:

https://brainly.com/question/8977000

#SPJ1

What is the effect of dramatic irony in the passage?
Twelfth Night, Act ll Scene V
by William Shakespeare (excerpt)

MALVOLIO: 'Besides, you waste the treasure of your time with a
foolish knight'

AGUECHEEK: That's me, I warrant you.

MALVOLIO: 'One Sir Andrew.'

AGUECHEEK: I knew 'twas I; for many do call me fool.

MALVOLIO: What employment have we here?

(Taking up the letter)

FABIAN: Now is the woodcock near the gin.

SIR TOBY: O, peace! And the spirit of humours intimate reading
aloud to him!

MALVOLIO: By my life, this is my lady's hand: these be her very
C's, her U's, and her T's; and thus makes she her great P's. It
is, in contempt of question, her hand.

AGUECHEEK: Her C's, her U's, and her T's. Why that?

MALVOLIO (Reads): 'To the unknown belov'd, this, and my good,
wishes.' Her very phrases! By your leave, wax. Soft! And the
impressure her Lucrece with which she uses to seal; 'tis my lady.
To whom should this be?

FABIAN: This wins him, liver and all.

MALVOLIO (Reads):Jove knows I love,
But who?
Lips, do not move;
No man must know.'
'No man must know.' What follows? The numbers alter'd!
'No man must know.' If this should be thee, Malvolio?

A.
The effect is heartening when all the other people listen to Malvolio speak.
B.
The effect is tragic when Malvolio thinks that the letter is written by Olivia.
C.
The effect is humorous when everyone except Malvolio knows Maria wrote the letter.
D.
The effect is serious when the others fail to realize the consequences of fooling Malvolio.

Answers

The effect is tragic when Malvolio thinks that the letter is written by Olivia is the effect of dramatic irony in the passage.

Option B is correct.

In the scene V of Act I, Scene V of Twelfth Night, what effect does dramatic irony have?

Shakespeare employs dramatic irony to create a comedic effect in the relationships between the characters in Twelfth Night. The majority of the comedic effect is achieved through the use of dramatic irony, which reveals situations and relationships to the audience but not to the cast.

What is Twelfth Night Malvolio's dramatic irony?

Shakespeare employs dramatic irony in this extract because the audience is aware that Maria, Sir Andrew, and Sir Toby wrote the letter to Malvolio, which was supposedly written by Olivia, but Malvolio's extreme self-love and delusion conceal the trick.

Learn more about Twelfth Night, Act:

brainly.com/question/28344614

#SPJ1

Read the paragraph and choose a sentence that describes it best. “I’m particularly excited to share some of the very early notions and sketches from when we were exploring what a new Star Wars destination should feel like,” adds Trowbridge. “Creating a never-before-seen place that simultaneously felt like the perfect stepping off point for adventure, that felt authentically Star Wars, and, that we could actually build in THIS galaxy was a challenging exploration with a huge obligation to get it right.”
Creating a new image for Star Wars series was the most important part of the whole process.
b) It was important to create new things that felt authentic to the franchise.
c) The sketches and notions are an essential part of creating a new image for the franchise.
d) The fact the creating a new image for Star Wars franchise was difficult and entertaining at the same time is the best thing.

Answers

The sentence that best describes it is (d). The fact that creating a new image for Star Wars franchise was difficult and entertaining at the same time is the best thing.

Trowbridge says that he was very excited to share some of the very early notions and sketches from when they were exploring what a new Star Wars destination should feel like. It was a very new experience for them. They had several ideas and then the team gets blank at another point. Overall it was very time demanding.

Creating a place which you have never seen sounds like a task which is exciting but at the same time very challenging. The challenge was also to make the place look like a perfect point of adventure.

To know more about Star Wars here

https://brainly.com/question/2744414

#SPJ1

Identify the answer that is correctly punctuated.

A. The teacher told the class to, "Get out their math books and turn to page twenty."

B. The teacher told the class to "get out their math books and turn to page twenty."

C. The teacher told the class to get out their math books and turn to page twenty.

D. The teacher told the class to get out their math books and turn to page "twenty".

Answers

The answer that is correctly punctuated is (B) "The teacher told the class to 'get out their math books and turn to page twenty.'"

How to Identify Sentences that are Correctly Punctuated?

Option B is correctly punctuated because the sentence is reporting a direct quotation from the teacher, and the quotation itself is a complete sentence. Therefore, the quotation should be enclosed in quotation marks, and the period should be placed inside the closing quotation mark.

Additionally, there is no need for a comma after "to" in this sentence. Option (A) includes an unnecessary comma, while option (C) omits the necessary quotation marks. Option (D) incorrectly places the closing quotation mark after "twenty," which is not a quotation.

Learn more about punctuation on:

https://brainly.com/question/27984016

#SPJ1

Notice that some of these nutrients are elements such as calcium. Is this food a good source of calcium? Why do you think so?​

Answers

Answer:

Because it tastes nice

Explanation:

The food you love will be good for you.

How to wake up at 4 am. Explain in 1000 words

Answers

Answer:

Get up

Explanation:

Use a alarm clock it will help you to get up. and if it still doesn't, then tell anyone in your family to throw water on you so you can get up.

(i cant write 1000 words lol)

Write about a time that a dream or expectation of yours
fell through or someone let you down.
What happened? How did you deal with this
disappointment?

Answers

Answer:well i mean my dad tried to kill me but besides that not much

Explanation:

Answer:

jbjnj

Explanation:

you could make a story up

"i have not been well since i returned from the hills"which is adverb clause​

Answers

Adverb clause of time – since I returned from the hills
Returned from the hills I believe:))
B
E
C
A
U
S
E

What is the best definition of a phrase?

A group of words with a subject and a verb; if removed, the sentence meaning is affected.
A group of words with a subject and a verb; if removed, the sentence meaning is not affected.
A group of words without a subject and a verb; if removed, the sentence meaning is affected.
A group of words without a subject and a verb; if removed, the sentence meaning is not affected.

Answers

The best definition of  phrase is "A group of words without a subject and a verb; if removed, the sentence meaning is affected." (Option C)

How many types of phrase are there?

A phrase is a set of words that function as a grammatical unit in syntax and grammar. For example, the English phrase "the extremely elated rabbit" is a noun phrase that includes the adjective phrase "very joyous." Phrases can be made up of a single word or a whole phrase.

The various types of phrase are:

Noun Phrase: Monday turned into a cold, rainy afternoon.

Verb Phrase: John could have been waiting outside for you.

Gerund Phrase; On a hot day, eating ice cream might be a fantastic way to cool off.

Infinitive Phrase: He assisted in the construction of the roof.

Prepositional Phrase; My father can be found in the garden.

Learn more about phrase:
https://brainly.com/question/139793
#SPJ1

Answer:

he best definition of  phrase is "A group of words without a subject and a verb; if removed, the sentence meaning is affected." (Option C)

Explanation:

Indicate any TWO roles that social media could play in a democratic society. (2x 1) (2) ​

Answers

Social media can play several roles in a democratic society. Here are two significant roles:

Mobilizing Activism and Civic Engagement: Facilitating Communication and Information Sharing:

How to explain the roles

Social media platforms have become powerful tools for communication and information sharing, allowing individuals to connect, express their opinions, and share news and information with a wide audience.

In a democratic society, social media enables citizens to engage in public discourse, exchange diverse viewpoints, and participate in conversations that shape public opinion. It provides a platform for marginalized groups to have their voices heard, fostering inclusivity and democratic participation.

Social media has the potential to mobilize activism and enhance civic engagement within a democratic society.

Learn more about social media on

https://brainly.com/question/3653791

#SPJ1

According to the video, flashbacks "can be helpful to better understand a character or a(n) ____." A. climax B. event C. setting D. theme

Answers

Answer: Event

Explanation: Already did it

Answer:

it is event, i got a 100

Explanation:

An introductory paragraph should

Answers

Any paper's introduction, regardless of how lengthy or how short it is, should begin with a hook sentence.

What is an introduction?

An introduction is the first section of an essay, article, or book where the aim and objectives of the remaining work are stated. Typically, the body and conclusion come afterwards.

No matter how long or how short a paper's introduction is, it should start with a hook sentence. In a typical essay, that initial line is followed by two or three additional that give specifics about your topic or your methodology.

Thus, these sentences all work together to support your text.

For more details regarding introduction, visit:

https://brainly.com/question/26523961

#SPJ1

How does this excerpt connect to the theme "Evil can never truly hide itself”?

Dr. Jekyll becomes Mr. Hyde and cannot transform back into himself.
Dr. Jekyll hides from his friends by living in a different London home.
Mr. Hyde becomes increasingly dangerous and hard to control.
Mr. Hyde commits acts of great violence in the London community.

Answers

The excerpt that best connects to the theme "Evil can never truly hide itself" is "Mr. Hyde becomes increasingly dangerous and hard to control."The correct answer is option C.

This theme suggests that no matter how well evil tries to disguise itself or remain hidden, its true nature will eventually be revealed. In the case of Mr. Hyde, his evil nature gradually becomes more pronounced and uncontrollable.

Throughout the story of "Dr. Jekyll and Mr. Hyde" by Robert Louis Stevenson, Dr. Jekyll creates a potion that allows him to transform into Mr. Hyde, his alter ego embodying his dark desires.

Initially, Jekyll is able to maintain control over Hyde and keep his existence a secret. However, as time goes on, Hyde's evil nature becomes more dominant and harder for Jekyll to suppress.

As Hyde becomes increasingly dangerous and hard to control, his true nature starts to manifest itself in his actions. This is depicted in option D, where Mr. Hyde commits acts of great violence in the London community.

These violent acts serve as evidence that evil cannot remain hidden indefinitely and will eventually reveal itself in its true form.

In conclusion, the excerpt connecting to the theme "Evil can never truly hide itself" is option C, as it illustrates the gradual escalation of Mr. Hyde's dangerous and uncontrollable nature, ultimately exposing the impossibility of concealing evil indefinitely.

For more such questions on excerpt,click on

https://brainly.com/question/21400963

#SPJ8


The Probable question may be:

How does this excerpt connect to the theme "Evil can never truly hide itself”?

A. Dr. Jekyll becomes Mr. Hyde and cannot transform back into himself.

B. Dr. Jekyll hides from his friends by living in a different London home.

C. Mr. Hyde becomes increasingly dangerous and hard to control.

D. Mr. Hyde commits acts of great violence in the London community.

How does the speaker strengthen her use of ethos in this excerpt? She repeats “fish” to emphasize that fish are the best choice for the classroom project. She repeats “first memories” to emphasize that she has a long history of experience with animals. She repeats “mother” to suggest that she has the same knowledge about animals as her mother does. She repeats “birdcages” to show that caring for birds is more difficult than caring for fish.

Answers

The speaker strengthen her use of ethos in this excerpt as C. She repeats “mother” to suggest that she has the same knowledge about animals as her mother does.

How to illustrate the information?

It should be noted that ethos simply means custom or character. It should be noted that ethos simply means the personality of an individual that can be used to persuade other people.

In this case, the speaker strengthen her use of ethos in this excerpt as she repeats “mother” to suggest that she has the same knowledge about animals as her mother does.

Therefore, based on the information given, the correct option is C.

Learn more about ethos on:

brainly.com/question/13889

#SPJ1

Other Questions
dentifying prevention strategies for adolescents to reduce their risk of depression: a delphi consensus study Why did you choose your proposed course and institution As a result of trade, specialization in the Ricardian model tends to beA. complete with constant costs and with increasing B. complete with constant costs and incomplete withincreasing costs.C. incomplete with constant costs and complete with D. incomplete with constant costs and incompletewith increasing costs.increasing costs.E. None of the above. what is 30% of 90??? a bear spies some honey and it takes off from rest accelerating at a rate of 2.0m/s2. if the honey is 16m away, how fast will his snout be going when the bear reaches the honey? A confidence interval for a population mean has a margin of error of 3.5. a) Determine the length of the confidence interval. _____b) If the sample mean is 51, obtain the confidence interval. Confidence interval: (___ , ___ ). Layla carelessly ran a red light and struck Fred, a pedestrian, all in full view of several bystanders. When Fred sued Layla for damages, all the witnesses testified that Layla did indeed run the light. Nevertheless, the jury found Layla not negligent and not liable for the injuries. The judge, however, responding to a motion from Fred's attorney, found Layla to be negligent and liable, on the basis of the evidence presented at trial. Which of the following statements best describes the judge's action? A. an appeal judgment, or a judgment in absentia B. an improper action; Fred (or Fred's attorney, on Fred's behalf) should have appealed to a higher court C. summary judgment directed verdict D. judgment n.o.v 2. A farmer earns $4 for each bushel of corn he sells. The equation y = 4x can be used torepresent this situation, where x is the number of bushels of corn sold and y is the total amountearned. What is the range that would represent this situation if no more than 1,000 bushels ofcorn are sold? an inflated baloon has a mass of 10 grams and a charge of 0.002 coulomb. the balloon is placed in a room with a horizontal electric field of magnitude 1 volt/meter. what is the magnitude of the electrical force acting on the the balloon i need help i will give 19 po.ints Name three tools that can be sharpened using a bench or pedestal grinder? A; 1. 2. 3. Read the excerpt from Gilgamesh: A New English Version.Enkidu said, "Don't worry, my friend,the dream you had is a favorable one.The eagle that you saw, with a lion's head,stands for Humbaba. Though it dived straight toward youand terrifying flames shot from its mouth,nothing could cause you harm. The young manwho came to your rescue was our lord, Shamash.He will stand beside us when the monster attacks.Whatever happens, we will prevail."Which statement best describes the epic feature used in this excerpt and its effect on the plot? The north and south held different views toward slavery in 1850. what were they? Choose three laws from Hammurabis Code (Links to an external site.)Links to an external site. and describe who is involved, what each law describes to do or not do, the consequences for breaking these laws, and howif at allthe Agricultural Revolution may have influenced these laws. I just need a sentence of the three laws 6. Write the sequence of the mRNA transcript that corresponds to the following gene segment of duplex DNA; indicate which of the two sequences represents the coding strand. Initiation site 5'TATAATGCGCCCATCATGCCGCTAGATTAGA3' 3'ATATTACGCGGGTAGTACGGCGATSTAATCT5' Sam Journeyman derives income as a professional beach dodge ball player.During the 2017/18 tax year, Sam received the following amounts:Tournament Prizemoney from dodge ball$ 85,000Appearance fees from dodge ball tournaments12,000Cash sponsorship from Aussieboom60,000Jetski provided by Aussieboom as a sponsorship benefit8,000Interest from bank account comprising savings from Prizemoney3,700Director fees from Dodgeball Australia. Sam is a director of Dodgeball Australia.14,500Car provided by Dodgeball Australia as a benefit7,200Required:Calculate Sams taxable professional income for the 2017/18 tax year.Calculate Sam's other taxable income for 2017/18 tax year Learning Task 4: Watch the Disney movie entitled Tangled. If you havent watched it yet, you may still view it For this activity, you may also use any movie that you have watched or story that you have read. Then, answer the questions that follow. Write your answers in your notebook. 1. Who are the main characters of the story? 2. What is the setting of the story? 3. Using a story map, explain the plot of the story: a. exposition, b. conflict, c. climax, and d. resolution? 4. What social conditions are portrayed in the story? What did the British do as a result to avoid this dispute again? American revolution (stamp act) Someone please helpppp Ive been trying so hard to figure this out someone please help!!!! Find the precent of markup if the cost to the store is $250 and the store is selling the TV for $312.50