Write a program that prompts the user to input a positive integer. It should then print the multiplication table of that number.

Answers

Answer 1

The required program in given below in which the user is prompted to enter a positive number, the program then print the table of that entered number.

#include <iostream>

using namespace std;

int main()

{

   int num;

   cout<<"Enter a Positive  Number : ";  //prompts the user to enter a number

   cin>>num;       // number is entered

   for (int i=1;i<=10;i++)  // for loop to calculate the table

   cout<<num<<"*"<<i<<"="<<num*i<<endl;   // prints the table

 

   return 0;

}

The program with its output is given in the attachment.

You can learn more about table using for loop at

https://brainly.com/question/12973360

#SPJ4

Write A Program That Prompts The User To Input A Positive Integer. It Should Then Print The Multiplication

Related Questions

Write a program to help an analyst decrypt a simple substitution cipher. your program should take the ciphertext as input, compute letter frequency counts, and display these for the analyst. the program should then allow the analyst to guess a key and display the results of the corresponding "decryption" with the putative key.

Answers

Every character in plaintext is swapped out for a different character in simple substitution cyphers. One should perform a reverse substitution and change the letters back in order to decrypt ciphertext.

What is a straightforward instance of a substitution cypher?

Any character of plain text from the predetermined fixed set of characters is replaced by another character from the same set according to a key in a substitution cypher. For instance, with a shift of 1, B would take the place of A, and so on.

What does Python's simple substitution cypher mean?

An Easy Substitution Letters are swapped out in cyphers. The total number of possible substitutes is 26 for the letter A, 25 for the letter B, 24 for the letter C, and so on.

To know more about cyphers visit:-

https://brainly.com/question/14449787

#SPJ4

what must all network interface card's (nics) on the same network use in order to communicate with each other on the same network?

Answers

All network interface cards (NICs) on the same network use frame types to communicate with each other on the same network.

Which NICs are included?

A NIC contains the electronic circuits necessary for communication over a wired connection (such as Ethernet) or a wireless connection (such as WiFi). Network interface cards are also known as network interface controllers, network adapters, or local area network (LAN) adapters.

What is a network interface card?

A network interface card (NIC) is a hardware component (usually a circuit board or chip) installed in a computer to allow it to connect to a network. There are two types of NIC he Ethernet NIC. Wi-Fi NICs.

Where are network interface cards used?

A NIC is used to create an additional communication port, such as on a computer, so that it can be connected to a network. This often refers to the connection being wireless (Wi-Fi) or the Internet via an RJ45 Ethernet cable.  

To learn more about network interface card visit:

https://brainly.com/question/29645518

#SPJ4

b. What significant values have you learned while learning the tools and utensils?

Answers

Attempts to use computer technologies to enhance learning began with the efforts of pioneers such as Atkinson and Suppes (e.g., Atkinson, 1968; Suppes and Morningstar, 1968). The presence of computer technology in schools has increased dramatically since that time, and predictions are that this trend will continue to accelerate (U.S. Department of Education, 1994). The romanticized view of technology is that its mere presence in schools will enhance student learning and achievement. In contrast is the view that money spent on technology, and time spent by students using technology, are money and time wasted (see Education Policy Network, 1997). Several groups have reviewed the literature on technology and learning and concluded that it has great potential to enhance student achievement and teacher learning, but only if it is used appropriately (e.g., Cognition and Technology Group at Vanderbilt, 1996; President’s Committee of Advisors on Science and Technology, 1997; Dede, 1998).

The Great Translation Movement first originated among several Chinese subreddits on the Reddit forum. Its participants called for the translation and release of speeches supporting the Russian invasion on the Internet of the People’s Republic of China to foreign platforms, "hoping that people from more countries can We know that the Chinese are not warm, hospitable, and gentle like the official propaganda; they are arrogant, populist, and unsympathetic. "

The Great Translation Movement is "focusing on maliciously smearing China. Participants one-sidedly intercepted some radical remarks on Chinese social media, which not only caused heated debates among Chinese netizens, but also induced foreign readers to anti-China.

The Great Translation Movement "never thought about resolving conflicts and alleviating conflicts", "intensified and added fuel to the flames", "its deeds are abominable, and its heart can be punished". Turning a deaf ear, elevating the radical remarks of some netizens to the level of the entire country and the entire nation, the clumsy hype methods are shocking, and the sinister intentions are clearly revealed, which can only arouse the heartfelt disgust and spurn of peace-loving people all over the world

Answers

The Great Translation Movement, originating from Chinese subreddits, aimed to translate and disseminate speeches supporting the Russian invasion on the Internet of the People's Republic of China to foreign platforms.

Its participants sought to portray Chinese people as arrogant, populist, and unsympathetic, contrary to the official propaganda of warmth, hospitality, and gentleness. However, the movement has been criticized for its malicious smearing of China and for amplifying radical remarks from Chinese social media, leading to heated debates among Chinese netizens and fostering anti-China sentiments among foreign readers.

Critics argue that the Great Translation Movement lacks the intention to resolve conflicts or alleviate tensions. Instead, it exacerbates and fuels existing conflicts, displaying abominable actions and a punitive mindset. By willfully ignoring the diversity of opinions and elevating the radical remarks of a few netizens to represent the entire country and its people, the movement employs shocking and clumsy methods to generate hype. Its sinister motives become evident, invoking strong disgust and rejection from peace-loving individuals worldwide.

It is important to note that the provided statements reflect a particular viewpoint or narrative about the Great Translation Movement and its impact. Different perspectives may exist on the nature and consequences of such movements, and a comprehensive understanding requires considering a wide range of opinions and sources.

Learn more about disseminate here

https://brainly.com/question/14434852

#SPJ11

What is the name of the item that supplies the exact or near exact voltage at the required wattage to all of the circuitry inside your computer?

Answers

Answer:

It's the power supply

Explanation:

The power supply is what essentially enables the computer to operate. It is able to do that by converting the incoming alternating current (AC) to direct current (DC) at the correct wattage rating that is required by the computer to function. The power supply is a metal box that is generally placed in the corner of the case.

Large wikis, such as Wikipedia, can protect the quality and accuracy of their information by assigning users roles such as ________. All of the answer choices are correct. editor reader subject matter expert

Answers

People or web do wants their privacy. Large wikis do protect the quality and accuracy of their information by assigning users roles such as Reader, Subject Expert and editor.

What is website quality?

Website quality is one that is said to be based on the quality of the software and output. Website Quality or say the Quality of Websites are said to be often measured from two views.

That is the Programmers, and End-users. The various aspects of website quality ranges from programmers who are based on the extent of Maintainability, Security, Functionality and others.

learn more about protection of quality  from

https://brainly.com/question/13171394


What would be printed to the screen when the following program is run?
function returnNumber() {
return x *5;
println(returnNumber(2));

Answers

Following are the correct Python program to calculate its output:

Program Explanation:

Defining a method "returnNumber" that takes "x" variable in the parameter.Inside the method, a return keyword is used that multiplies the parameter value by 5 and returns its value.Outside the method, a print method is declared that calls the "returnNumber" method which accepts an integer value into the parameter.

Program:

def returnNumber(x):#defining a variable returnNumber that x variable in parameter

   return x*5;#defining a return keyword that multiply the parameter value by 5

print(returnNumber(2))#calling method returnNumber that takes integer value in parameter

Output:

Please find the attached file.

Learn more:

brainly.com/question/13785329

What would be printed to the screen when the following program is run?function returnNumber() {return

what level of system and network configuration is required for cui

Answers

FISMA Moderate Level (The Federal Information System Modernization Act

CUI needs a moderate network under Federal Information System Modernization Act.

What is controlled unclassified information?

Under Executive Order 13526 "Categorized Nat'l Security Information" or the Nuclear Safety Act, as amended, policed classified material (CUI) is information that needs to be protected or disseminated under controls in accordance with applicable laws, regulations, and federal governmental policies.

The Executive Branch must "set up an open and attire program for managing [unlabelled] data that requires working to protect or distribution controls in conformance with and reliable with laws, rules and regs, and State policies," according to Executive Order 13556, Controlled Confidential Information.

Hence "According to the Federal Information System Modernization Act, CUI requires a modest network".

To learn more about controlled unclassified information,

https://brainly.com/question/29662341

#SPJ12

Which tools would you use to make header 1 look like header 2? select all that apply.

Answers

Use the Align and Bold tool icons to make Heading 1 look like Heading 2.

How to create header row 1 in Excel?

Click anywhere in the table. On the Home tab of the ribbon, click the down arrow next to Tables and select Toggle Headers.

How to create a headline 1?

How to add heading styles

Enter the desired text in your Word document.

Select the sentence you want to add a heading to.

Select Home > Style (or press Alt+H, L) and select the heading you want. B. Heading 1 button.

How can I make the first row a heading?

To promote the first row to column headings, select Home > Use First Row as Headings. To demote the column headings to the first row, select Home, select the arrow next to Use first row as headings, then Use headings as first row Choose.

To know more about Align visit;

https://brainly.com/question/14517960

#SPJ4

Make Heading 1 resemble Heading 2 by using the tool icons for Align and Bold.

How can I make row 1 of Excel's header?

In any part of the table, click. Select Toggle Headers by clicking the down arrow next to Tables on the Home tab of the ribbon.

How can I write headline number 1?How to incorporate heading styles?

Your Word document will need the necessary text entered.

Choose the passage to which you wish to add a heading.

Select the desired heading by choosing Home > Style (or by pressing Alt+H, L). Button for Heading 1.

How can I create a heading for the first row?

Select Home > Use First Row as Headers to convert the first row into column headings. Select Home, click the arrow next to Use first row as headings, then select Use headings as first row Choose to relegate the column headers to the first row.

To know more about Align visit;

brainly.com/question/14517960

#SPJ4

Q Which Tools Would You Use To Make Header 1 Look Like Header 2? Select All That Apply. Header 1 1 First Name, Last Name, RSVP

what is UTP in terms of network​

Answers

Answer: Unshielded bent match (UTP) could be a omnipresent sort of copper cabling utilized in phone wiring and neighborhood region systems (LANs). There are five sorts of UTP cables recognized with the prefix CAT, as in category each supporting a distinctive sum of transfer speed.

Explanation:

Firewalls work on Transport layer. Which means they can perform
the functions of lower layer devices such as routers. Is that true
? Please briefly explain usage of firewalls as routers.

Answers

Firewalls and routers have distinct roles within a network. While firewalls can operate at the Transport layer and enforce security policies, they are not intended to replace routers but to complement them by providing an additional layer of network security.

The statement that firewalls work on the Transport layer and can perform the functions of lower layer devices such as routers is not entirely accurate. Firewalls primarily operate at the Network and Transport layers of the OSI model, but their main purpose is not to replace routers.

Firewalls are network security devices designed to monitor and control incoming and outgoing network traffic based on predetermined security rules. They act as a barrier between internal and external networks, enforcing security policies to protect the network from unauthorized access, threats, and malicious activities.

While routers operate at the Network layer and are responsible for forwarding packets between networks based on IP addresses, firewalls focus on traffic filtering, access control, and network security policies. Firewalls can inspect the packets at the Network layer to make decisions about whether to allow or block certain traffic based on rules defined by network administrators.

Although firewalls and routers have overlapping functionalities, they serve different purposes in a network infrastructure. Routers handle the routing of packets between different networks, ensuring efficient data transmission, while firewalls focus on securing the network by filtering and controlling traffic flow.

In some cases, advanced firewalls may include routing capabilities, allowing them to perform basic routing functions along with their primary security functions. This can be useful in scenarios where there is a need to combine routing and security functionalities in a single device, such as in small or branch office environments. However, it's important to note that the primary role of firewalls is still focused on network security rather than routing.

In summary, firewalls and routers have distinct roles within a network. While firewalls can operate at the Transport layer and enforce security policies, they are not intended to replace routers but to complement them by providing an additional layer of network security.

Learn more about Firewalls here

https://brainly.com/question/32221325

#SPJ11

''/--//.I want a new account///.--/'''

Answers

Answer:

nice cause nice

Explanation:

it's nice due to you wanting a new account

Answer:

Instead of signing into this account, you can click on "sign up" and then create a new account..

Explanation:

If that doesn't work, then I'm sorry.

Have a great day, or night, wherever your at, and always know that I'm here if you need someone to talk to if something or someone is bothering you.

Question 14 of 20
What does action mean when solving a problem?
A. Thinking of different ways to solve the problem
B. Implementing the best solutions you came up with
C. Thinking of potential solutions and determining which will work
D. Figuring out what you want and what stands in the way of a
solution

Answers

Answer: B. Implementing the best solutions you came up with.

Explanation: with A C and D you’re only thinking but not taking action

In this lab, select view lab and type uptime -h to find the correct option to answer the following questions: on which date was the corpdata server started?

Answers

The command "uptime -h" displays the uptime information of the system and also the time when the system was last started. The "-h" option is used to display the output in a human-readable format.

To determine on which date the corpdata server was started, we can run the "uptime -h" command and look for the line that says "up since". The date and time following this line represent the time when the server was last started. Therefore, we can determine the date on which the corpdata server was started by simply reading this line of the output.To use the uptime command with the -h option, simply type "uptime -h" into a terminal or command prompt and press Enter. This will display the system's uptime in a human-readable format that includes the current time and date as well as the amount of time that has elapsed since the system was last booted up.

Once you have the output from the uptime -h command, you can look for the line that begins with "up" to determine the date and time when the system was started. The date and time will be listed at the beginning of this line, immediately after the word "up". This should allow you to determine the date when the corpdata server was started.

Find out more about  corpdata server

brainly.com/question/29512309

#SPJ4

Select all the correct answers.
In which TWO ways does e-governance empower citizens?

Citizens can obtain information directly from government websites.
Citizen can easily fix appointments with senators online.
Citizens do not need to travel to government offices.
Citizens can vote online on the bills introduced in the legislature.


i will have more questions under ur answers

Answers

Answer:

Citizens can obtain information directly from government websites.

Citizens do not need to travel to government offices.

Explanation:

These seem the most appropriate to me.

Write a program whose inputs are three integers, and whose output is the smallest of the three values. ex: if the input is:

Answers

Answer:

who knows y should ask your teacher or something

Explanation:

that is the easy way to make you self clear

Which of the following is not a good file-management practice?

A. Create descriptive names for folders and files.
B. Store all of the data files at the top level of the drive to make them easier to find.
C. Remove folders and files when they are no longer needed.
D. Make enough subfolders so that the files in any one folder are readably visible.

Answers

Answer:

B, Store all of the data files at the top level of the drive to make them easier to find.

Explanation:

Your files will be unorganized, and it will actually do the opposite of what you want it to.

Hope this helps!

The following is not a good file-management practice Store all of the data files at the top level of the drive to make them easier to find. Thus the correct option is B.

What is file management?

File management is referred to as a systematic technique that allows an individual to store their valuable data and information in the forms of files and documents in an organised manner to retrieve it properly.

File management is crucial since it keeps the files of an individual orderly. It could make it simpler for them to locate files when they need to utilize them. It is crucial for organizations since it makes it simpler for them to share folders with their staff or customers.

File management allows an individual to store their information with descriptive names for easy access and remove files that are not required.

It also enables to make of subfolders so that the files belonging to separate departments or folders are visible to the reader without creating any kiosk.

Therefore, option B is appropriate.

Learn more about File management, here:

https://brainly.com/question/12736385

#SPJ6

the security rule requires that covered entities and business associates implement which type of safeguard to protect electronic data?
administrative, technical,
physical safeguards
Access control

Answers

The procedures and controls used to restrict or regulate access to electronic systems and data are referred to as access control.

What does a business partner do?

Claim processing or administration, data analysis, processing or administration, usage review, quality assurance, billing, benefit management, practise management, and repricing are examples of business associate functions and activities.

What does a business associate look like?

Lawyers, accountants, IT contractors, billing businesses, cloud storage providers, email encryption services, web hosts, etc. are a few examples of Business Associates. (This list might continue forever.) With these folks, you must have a business associate agreement.

To know more about electronic systems visit:-

https://brainly.com/question/28166552

#SPJ4

explain at least three important events during the first generation of programming language?

Answers

Answer:

Python, Ruby, Java, JavaScript, C, C++, and C#.

Explanation:

A programming language is a type of written language that tells computers what to do. Examples are: Python, Ruby, Java, JavaScript, C, C++, and C#. Programming languages are used to write all computer programs and computer software.

Prompt the user for the name of their favorite hobby and store it in a variable
java

Answers

Below is an example of how you can prompt the user for their favorite hobby and store it in a variable in Java:

import java.util.Scanner;

public class Main {

 public static void main(String[] args) {

   Scanner input = new Scanner(System.in);

   System.out.print("What is your favorite hobby? ");

   String hobby = input.nextLine();

   System.out.println("Your favorite hobby is: " + hobby);

What is the java about?

This code imports the Scanner class from the java.util package, which allows the program to read input from the user. Then, it creates a new Scanner object called input, which reads input from the standard input stream (usually the keyboard).

The System.out.print() method is used to display the prompt "What is your favorite hobby? " on the screen, and the input.nextLine() method is used to read the input from the user and store it in the variable hobby.

So, After the user inputs their hobby, the program will then print the variable hobby to confirm the input.

Learn more about java from

https://brainly.com/question/26789430

#SPJ1

i need freinds.:(plz

Answers

Answer:

Explanation:

sure wassup

Answer:

i'll be your friend!

Explanation:

when a switch receives a frame on a port and floods the frame, what does it do with the frame?
a. Discards it
b. Changes the destination address to FF:FF:FF:FF:FF:FF
c. Forwards it out all other connected ports
d. Clears the switching table and adds the frame source address to the table

Answers

A switch floods all other associated ports with a frame when it gets one on a port and sends it out.

What happens to a frame once it is received by a switch?

When a switch gets a broadcast frame, it sends the frame out of all of the switch ports aside from the ingress port where the frame was received as a broadcast frame. The top broadcast domain illustrates how each linked device receives a copy of the broadcast frame and processes it.

When does the flooding occur when a switch?

Flooding describes the switch sending the incoming frame to every active and occupied port (except for the one from which it was received). Flooding is essentially when a switch impersonates a hub.

To know more about switch visit:-

https://brainly.com/question/29691930

#SPJ4

One part of a development team has completed an algorithm. Why is it important to share it with others on the team? Choose all that apply. If it is easy to understand, no one will dispute what is included in the algorithm. It will give everyone else an opportunity to comment on the process described in the algorithm. It will serve as the starting point for all future activity. It communicates the consecutive instructions of the solution.

Answers

Answer: B,C,D

Explanation:

Answer:

the answer is B,C,D

Explanation:

which cellular network type can, theoretically, provide speeds up to 10gbps?

Answers

The cellular network type that can theoretically provide speeds up to 10Gbps is 5G.

5G, the fifth generation of cellular network technology, has the potential to deliver speeds up to 10Gbps (gigabits per second) in ideal conditions. This is a significant improvement over the previous generation, 4G LTE, which typically offers speeds in the range of 100Mbps to 1Gbps.

5G achieves these high speeds through the use of advanced technologies such as millimeter wave (mmWave) frequencies and massive multiple-input multiple-output (MIMO) antenna systems. MmWave frequencies have a larger bandwidth available, allowing for faster data transmission. Massive MIMO utilizes a large number of antennas to enhance capacity and improve network performance.

In addition to speed, 5G offers lower latency, which means there is less delay in data transmission, resulting in a more responsive network. This is especially crucial for applications like real-time gaming, autonomous vehicles, and remote surgeries, where even milliseconds of delay can have a significant impact.

However, it's important to note that the actual speeds experienced by users on a 5G network can vary depending on several factors. These factors include the distance from the cell tower, network congestion, signal interference, and the device being used. Additionally, the highest speeds are typically achieved in densely populated urban areas with extensive 5G infrastructure.

Learn more about Cellular network  

brainly.com/question/32896643

#SPJ11

……………………is one of the most popular cloud storage facilities.​

Answers

Chcgzrsfchvuvjbnkggvbbb.

Which of the following is considered a variable?
(1 point)
O size
O collisions
O particles
O lights

Which of the following is considered a variable?(1 point)O sizeO collisionsO particlesO lights

Answers

Answer:

the following that is considered that is a variableis c particles

Explanation:

You should enter a formula that subtracts the data in cell B4 from the total of cells B2 and B3. What should the formula look like?

Answers

Use this formula:

=(B2+B3)-B4

Which business case is better solved by artificial intelligence (ai) than conventional programmin

Answers

The business case is better solved by artificial intelligence (ai) than conventional programming are:

AI used for Industrial Operations such as  the consistent Process Optimization to make better Product Quality

AI is used in changing Advertising and Marketing such as in the Personalization works.

What is Artificial intelligence?

Artificial intelligence(AI) is a term that connote the ability of machines to be able to act or be like themselves or one that make human-like decisions so as to carry on tasks.

Hence, The business case is better solved by artificial intelligence (ai) than conventional programming are:

AI used for Industrial Operations such as  the consistent Process Optimization to make better Product Quality

AI is used in changing Advertising and Marketing such as in the Personalization works.

Learn more about programming from

https://brainly.com/question/27959437

#SPJ1

can someone pelaseee help

can someone pelaseee help

Answers

Answer:

Explanation:

develloppemetn de grace en option est logiquement une biologiste experimenter des annes 1256 a toulouse en france

How do i fix this? ((My computer is on))

How do i fix this? ((My computer is on))

Answers

Answer:

the picture is not clear. there could be many reasons of why this is happening. has your computer had any physical damage recently?

Answer:your computer had a Damage by u get it 101 Battery

and if u want to fix it go to laptop shop and tells him to fix this laptop

Explanation:

Other Questions
A perfect square trinomial factors to what type of factors(s)?Binomial squaredSum and differenceA common factor Which of the following is not a factor considered by the courts when evaluating the reasonableness of an employee's compensation?A) The number of hours worked and the duties performed by the employee.B) The amount of compensation paid by other corporate employers in the same line of business to unrelated employees performing the same or similar services.C) The employee's education and years of experience.D) All of the above factors are considered. Why is wind created when cold air rushes into an emptier space?A: The water cooled the air and attracted more cold air.B. Warm air was being pulled to the right of the air mass.. As the air was warmed at a lower altitude, it then warmed Earth's surface.D. As the air was warmed near the Earth's surface, it became less dense and rose. abnormal condition of stiffening of the tiny bones of the ear seasonal affective disorder (sad) is associated with reduced exposure to sunlight. malfunction of the thyroid gland. a lack of social interaction. too much external stimuli. Like statutory law, administrative law is created by legislatures. Administrative agencies at various levels of government work together and share the responsibility of enforcing particular regulations. Business has little incentive to try to influence the regulatory though lobbying. what are the three v's big data that often define its characteristics? Which of the following blood vessel layers is primarily composed of smooth muscle fibers and plays a major role in controlling the diameter of the blood vessels (i.e. vasoconstriction and vasodilation)?A. Tunica externaB. Tunica mediaC. Tunica interna SECTION I: DEMAND AND SUPPLY ANALYSISa. What happens to the equilibrium price and equilibrium quantity of ice cream in response to each of the following? Explain your answers. i. The price of dairy cow fodder increases. ii. The price of beef decreases. iii. Concern arise about the high fat content of ice cream. Simultaneously, the price of sugar (used to produce ice cream) increases. b. What will happen to the equilibrium price and equilibrium quantity in the fresh seafood market if each of the following event happen: i. A scientific report is issued saying that fish contains mercury, which is toxic to humans. ii. The price of diesel fuel (used to operate fishing boats) falls significantly. explain how an s-shaped curve depicts a pattern of population growth where resources are not unlimited. Look at the refrigerator. _______ you will see the dishwasher. Which of the following is true regarding vomiting?A. It can lead to dehydrationB. It is rarely a sign of serious illnessC. Vomiting blood often indicates a serious illnessD. Both A&C purpose of a __________ is to provide leverage to a trade contractor to receive payment for goods and services provided in the construction of a building project How can we prevent The spread or Disease? he distribution of scores on a recent test closely followed a normal distribution with a mean of 22 points and a standard deviation of 2 points. for this question, do not apply the standard deviation rule. (a) what proportion of the students scored at least 29 points on this test, rounded to five decimal places? (b) what is the 71 percentile of the dis Describe the symmetry of the figure. Identify lines of symmetry, if any. Find the angle and the order of any rotational symmetry. HELP AS SOON AS POSSIBLE!!! Hello, Been on with 3 tutors who couldn't help, hope you could. See photo. I understand it partially but not fully. Emeline has a shoe box measuring 11 x6x8. Noah has one measuring 12 x 5 x 7. What is the difference is surface areabetween their boxes? 10. Define what is meant by pump characteristic' and system characteristic and explain how these are used to determine pump performance. 15 marks] 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA